GenePrediction:GLEAN_2366 Details

Name: GLEAN_2366
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:703631..704728 (+ strand)
Length: 1098
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:703631..703649 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_140:703705..703767 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_140:703827..704728 (+ strand)
Length: 902
>GLEAN_2366 class=GenePrediction position=GCSC_140:703631..704728 (+ strand)
ATGCACAGCAAGGTTGTCGGTATGTGACATGAGCTCCATCCGTCGTAATGCTTCTCCAGACTGACCTCCCGCAGTTATCG
GCTCTGGCCCCGCCGCCCACACGGCCGCCATCTATCTGGCCCGTGCCAATCTGAAGCGTGGGTGTTTTCTTTCTTTCTTT
TTTTTCTCCCCTCCTTCTCCATCACTAACAAAACAGCGGTCCTGTATGAGGGCTTCATGGCCAACGGCGTCGCCGCCGGC
GGCCAGCTGACCACCACCACCGAGATCGAGAACTTTCCCGGCTTTCCCAATGGAATCATGGGCAGCGAGCTGATGGAGAA
GCTGCGCGCCCAGTCGGTGCACTTTGGCACCGAGGTCATTACCGAGACCGTCGCCACGCTCGACCTGTCTGCCAAGCCGT
ACCGCTACACGCTTGAGTGGACGCCCGACGAGATCCACACGGCCGATGCCGTCATCGTGGCCACCGGCGCCTCCGCCCGC
CGTCTCGGCCTGCCCGGCGAGGAGAAGTACTGGCAGAACGGCGTCTCTGCCTGCGCTGTCTGTGATGGTGCTGTGCCCAT
CTTCCGTCAGAAGCCGCTCGTCGTCATCGGCGGCGGCGACTCGGCCGCTGAGGAGGCCATGTACCTTACCAAATATGCCA
GTCACGTGACTGTCCTCGTCCGTCGCGACAAGCTCCGTGCCAGCGACATCATGGCCAAGCGCCTGCTGGCCCACAAGCAG
GTCACCGTCCGCTGGAATTCGGGCGGCGTTGAGATCCAGGGCGACGGCAAGCTCATGACCCACTTGGTCGTCAGGGACCA
CAAGACCGGCGAGCTCGAGACTCTCCAGGCCAACGGTCTCTTCTATGCCATCGGCCACGACCCTGCCAACAGCCTTGTCA
AGGGCCAGGTCGACACCGACGAGGACGGCTATATCATCACCAAGGCCGGTACCCCCCTCACCAGCAAATCTGGTGTCTTC
GCCGCCGGCGACGTTCAGGACAAGCGCTACCGCCAGGCCATCACCAGCGCCGGCTCCGGCTGCATGGCTGCCCTCGAGGC
CGAAAAGTACCTCGCTGATCTCGAGGCCGACGAGGCCGCCAAGGAGAGCAGCCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62