GenePrediction:GLEAN_2367 Details

Name: GLEAN_2367
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:711225..715603 (+ strand)
Length: 4379
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:711225..711316 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_140:713110..713374 (+ strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_140:713526..715221 (+ strand)
Length: 1696
Type: CDS
Source: GLEAN
Position: GCSC_140:715293..715603 (+ strand)
Length: 311
>GLEAN_2367 class=GenePrediction position=GCSC_140:711225..715603 (+ strand)
ATGCACCAAGGCGGGCTGGCAGCCTGGGACGAGAACAACAAAGCATACTCGCACGTGTACGAGCATGTGCCACCATGGTT
CGAAGACATACCGTAAGTTGCAGGAGGTGTTTATTGGAGCCTGTCAGGCGAAACGTGTCCCCGTCATTGTCAGGCGTGCT
GTTACTGCCCCACTGCTGGGAACTCAATGAAGTGGGCCGGTGGCCAGAACAGCTAACCGGCTCAGCAGCTCTTGCAACTG
TTACGGCTGTTGCAGCAGCTGTCATGATGTGGACGCTTCGTGTTGTAACCGTTCGGACCCCAGTGCATCTGTCGGCTTCC
TTCTTCATTGGGCCGGGGAGGGGGTGGCCGTGGATCCGTGGGTGAGAGGGGCGTCGGGATTGACAAATGGCTGTGGCAAC
GTAGTGGAACATATCTCCATCACGGCCGCTGTGAGATAGGAGATAGGGGTCAGCAGGGCGACGGACGAATAAGAGAGAAA
AGGGAGTGAAAAAAGGGGGGGGGACAGAGAATAGGCGGTCATCGACACACCTTCTGGGCCGGGCCTTTGCCGATCGAACA
TGATTTCATTAATCGGCCTGGGCGATTGAGTGTAGGAAGACGGCCGCGAGTTGTGGGCTGATGGCTGGAGCGGTCCTCTG
ATTAGCTTCCGGTCGGGATTGCCGGTTTCGGTCGTGGGAGCCGGATGTGTGCTCTGTGGCGTGGTCGCGCGCGCCGACGC
CATGCTGGACGGTGCTCTCCGTTGCCCGTTGCCCGGTGCTGTCATCGGGGTGGAAGGAAATTCAAGTCAAGGGGAAAGCC
AGGGCCACGATTGGACGAGTGTTCGTGCTCGTACGTCGTAGCTCGAACCGGTCAGCGGGGAGGAGCTCCAGCGGGTAGAT
GGACCAGGAGAAAATGCAGAAATGAGTCACTGGATCCCAAGTCGAGCAAGAGCCAGCAGCGGGGCACAAGGGCCCGGTCA
GAAAGCGGGGCTTCGCAGTAGCAGAGCGGACTCTGCAAGATGGGGCAGGCCAACGTTGCAGCAGAAAGCTGCAAGGTCAA
GAGAGAAGAGGAAAGCTTTGTGCAGCTGGGAGTGGTGCTCTGGTCCGCAACGCCCATTGAGCCGACGGTGATTGGCAAAC
AGCTGGTCGATCAGTGCCGAGTCGCCACGGACATGCGACACTAGGCGTTACTATTGCAGAACTGCCTCGACCTTCTTGGA
CAGCTCAGACCTGCTCTTCTTGCCCTGGAGCAGAGGCAGCAAGGTCGATGCACAATGGGTGGACTCGTCACCCAAACGTG
CTTAGCTGCACCAGACTGATACTTGGTAGCGGCTGCCCATTCAAAAGGGTGCCTAGGCCCCACTCATGCATGGTTTGCAT
GCTCTCGCTTTCCGTAGTTGGCCAATCAGGCTAGCCGTCTGCTGTGGAGACGGGTCATTGTGGTACTCACGGCCAATCAG
GAGAGAGACTGGGGGCTAAGCACGCAAACTGCTGTACCCACATCTGTTCTTGGTGTGTTCTTTCCTAAGAACAGTGAAGG
ATTTTTTTTTTAGCCCGTCGCACTGCTCTTTCCCCCGCCCCCTCCGCCTTCGGGGCGGCCGTTCTTCCAATCCAACCTCT
GACTCTTGACAATTGCGAAAAAGACTGACTCGAAGTGCCGTCCCGTTCGTGTTTTATTTTACTGTATTGTTTGACCTCTG
CTGCTGTCTGCCGCTTGGTCGAAGCCAGACATCGAGGGCGAAACTGTCTGCGTCACCGAATGGGCACTGCCTTCAAGCTC
AGACATCTGCAGCAGACAGAATCTCAGACGTGCTAACAATTGCGACCTCGTCCTGCTCTCCCGTTTCTTTTTGTCATCCC
CCCCTCTCTTATACCATTACTCCACTCGCCCCCTCGGTCGGAGAGCGGCATTCCCTGTCTGTTCATGGATGGATCGCCAC
TCCTCGCAGCCGGCGGCGGTGCCTCTCTGAGCCCGACAAGCCCGGTGAGCGTCCGCAGCGTCATCAACATCAACGGCGTG
AAGAGAAAGAGGAGCACGGGTGCGCCTGCGAGCGCTGGCTTCGACAGCAGTCCCGGGAGCGTGTTGAACGACGACGATAA
CGGCGACCCGTCCGAGAAGAAGCGGCAACCAGGCGTCAAGCGCGCATGCAACGAGTGCCGCCAGCAAAAGGTGAGTTTTG
TCGTCTTCCGGCCGTCCGCCGGTATATTTCCGGCGCGTCGGCAGTACTCCGAATTACCTCCAGACCAGCTGCCCCCGTTG
CTGTCGTCTGCTGTGCACACGCCCCCCCCCCCCCCCGATCTGACTGACCTTTCTCGTCCAGCTTCGATGCGACGTCAGCC
AGGACCCCTTTCGCAGCTGCTCACGATGCAACCGGCTAAAGCTACAATGCAAGATCGAATCCAACTTCAAACGTATTGGC
AAGCGGTCCAAACACGCCGAGATGGAGAAGGAGATTGAGAAGCTACGGCGAAGCGTCCAGCTCGCCCGGTCCCAGGGCTT
CGTCATCGACGACGACGACGACGGCCCGTCCACGTCCCAGCTGCAGTCGCCCATCATCAACAGCGTATACACCCATACGC
GCAACCCGTCGTTGATGGGCTCCGACGAGGCCGTCTCGTCATTGCTGCATCTCAAGCGCGGCGGCTCCTACAGCGTCCCG
CGCATTGTGCGTGAGCTCGAAGAGGTCCGCCTGACCGAGGAAGGCGAGGCACAGCTGTTCCAGGACTTTTGGCTCTTCTA
CCACCCTTTCCTCCCCTTTCTCAATACCGCCTTGGCTCCAGAAGTGTACTACCAGCAGCATCCGCTGCTCTACTGGTCTA
TAGTCGCTGTGGCTGCCCGTCGATACGTCCCTGACCCGACTCTTCTCACAGCCATCTCCGTCCCGCTTAACACGCTCCTT
TGGAAGACCATCGGCGAGGTGCCCGGCTCGCACTTTGTCGTCAAGGCCATGTGTCTCCTCTGCACATGGCCGCTGCCTAC
CAGCAACACCAGCTCTGACCCTACCCACATCCTCTGCGGTGTCATGATGAAGACTGCCACCGGCATCGGCCTCCACCGTC
CGAATCACATCAACGACTTCACCCGCGTCGCCATCGAGCTGAACAAGGACCAGCTCCACGACCGTGTCGTCACCTGGGCC
GTGTGCAATATCGTCGCCCAGAACGTCGCCACTGGCTACGGCCAGCCAGCCTCTTCGCTGTACGACTGGACGCTTGCCAC
CCGGTCCGGCGAGTCTGGGCCCTTCCAGCTGTCTGCCGAGCTGGAGGCCCGCCTGCAGATCGAGCGCTTTTGCGACAAGG
TTTCTAAGGAGATGTACAGCAATGCCAGCGACTCCCGCGGCGTCGCTGGCGACGAGCACCGCTCCATGCTGATGCGCGTC
TTCCGCCGCGAGTATAGCGAGCTCCATGCCGATATCATGTCGCGTGGCTTGTCCCACATCGTGTCGTTCCATCTCAAGGC
CGCCGGGCTGCACCTGCGCCTGGCCGGCTTCTTCGATGCGAGCTCGACGCCTGGCTATCTCGACGACCTTATGGGGCTGT
GGCGCTCCACCGTCAGCTTCTTGGAAGACATCATCAGCAACAGCACCGTCTCGTCACCGTCGTCACCACAAGAGCACATC
GGTATTGATACGCTCAAATATGCATCAAACTACCTGCAGCAGATGCTGGTGGCCGCCGGCTTTGCCCTCCTCAAGCTGAT
GCGCTCGTTCTTTTCTCGTGCCATCGACTACGACCGCGGCCGGCGGCTCTTCCACCGGATCATCGGCGCTATCCGGTCCA
CCAGTGTGGTGCACAACGACCTCCAGTGGAGGCTAGCTGAGCTGATGGTGCAGATGTGGAATGGGGCCCGGCTAGAGACT
CAGCCGGCTCGGGCGTACCTGGACGACGACAGCGCTGTCGAGATTGACGACACCTTGCAGCTGAAGGTGCGCTGTCGGCA
CAGCATGAGCCTTGTCTTCGACTCCATCTGGCACTGGCGAGAAGAGTACCAGGCCAGGGGTCGAGGCACTCTGGATGGTG
GGTTTTGTCTTTTTCCCTTCGGCCCTTCGGGTCGCTCTGTTGTTATATACAGGACTAACGCAGCTCAGTTGCAGCTTTAA
AACAGCCAACCAACCCAGACTCGGCGAACGAGTCAACAGCCTCGTCCACGCATATGGATGCCGGCATAATGGCCTCTAAC
CACGGTCTTCCAAGCCTTCCAACGTCAGTCTCAAATGGCGCGCTGGCCGCTGGCATTACTGCAGGGCTGGCTGGACATGG
GCACAACGGTATGCTTGGAGGTGGAGTGTCGTATGACGCAAACCCAACTAGCTACGATTTCTTTGATCCTCAGCACTGGA
TGCTAGACAACCTTCTGGACTTCAACTACTCTTACGTGCCGCCCATGGAGGGTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62