GenePrediction:GLEAN_2368 Details

Name: GLEAN_2368
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:726628..728301 (+ strand)
Length: 1674
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:726628..727557 (+ strand)
Length: 930
Type: CDS
Source: GLEAN
Position: GCSC_140:727612..728301 (+ strand)
Length: 690
>GLEAN_2368 class=GenePrediction position=GCSC_140:726628..728301 (+ strand)
ATGCTGTCGACCTTTCAAGGTACGACTTCCGGCCTCATGCACACACCGCACACACCCTCGTTTGGGGAAAACTACGATCA
TTTCAGCGCGTACGGCGAGTCAACTGCACCGGATGCAACATCCCATTCGAACATGGAGTACAATTCTTTCTTGAACCCGA
ATCCCGCATACTATCCAACTGGACGGCCGCTTCCGCAGCCGCATCATCCTTACGACCAGCAGCAGCAGCAGCAGCAGCAG
CAGAGCCCACATGGCCTCCCAACGACGTCGATACCGTCCATGAGCCAGATGCACGCCGGCCAACAGCATCAGTCGTCGAT
GCCGCAGCACGCCCTCCCCATCATTGGGCATACGCATGCGCAGCCGCCGCAGTTCCGCGCATCTCGTGGTGGCACGAGTC
TCCAGGGATATAGAGATCCTACCACGCTGCACCCCGTGTACCAGAGCCAGACGCCGTCTACATCAGCGAAGCGTGTCCGC
CAAACGCCTACAGCAAGCACCCACTCGACCTTGTCTCTCGACGGCAGCGTTTCAGACGTCCAAAGCACTCCTAGAAGTAT
CGGCAGCGACATGCGAGCGTACATGGTTAGCGGAAGCGGCAATGCAGGCACCTTCGGCACGACTCGGTCAGGGTCTGATG
CGAATGTTAGCACCAGTTCGGCCACCGCTTCAAGAGTCAATGTGTCTCCGGAGCTGTTCGCCAGCGTCACTACTGATCAG
CCCTCTTTGGTGCTCAGCGAGAGGGCCAGCGAAGAAGATCGCTATCTGTTCGAGCTGCACGAACAGTTTAAGGGCACGCG
TGGCAAGGGCATGTGGGACGCCATCACGAGCCAGTACGCCGAGAGGTATCCCGGCTCACAGGCGACTGCCTGTTTGCAGA
TGAAGTTCACCCGGTGCTTCCGCCGGTTTATTCTTTGGCCAAAAGACGAGGTACGTTTATGTCGTTATCTTGTCCCCTTA
CGCTCATCTATTGACACTCTCTAGTTGGAATGCCTGTTGGAGGCGTGGCGTGAAGACGAAGCGCAGCGCTTTGCCCGGAT
CACAACGCTGATGAAGGAGAGGGGAGGTGGCAAAAAGCACGACTGGAAGCCTGCAGACATTGAGATGATTCTGGTCCGCC
TGGAACTCGAGGAAGCAGACATGGACGAATTCACGAAAATCCGCCGTCGTCGTCGCCGCACGAGGCAGCGCAAGTCGTCT
GCACCCAGCATTGCCAGTCAGCCGCACCATGCCGAAGTGGCCCCGGTCATGACAGCATCGACGTGGTCTGGTGGCTTCAG
TCCAGCTGGCCTGACTCACCCGCAGTACAGCTTGCCGCCACCCCAGCAGGACAACGTCAACTACTCGCACTACGACGAGG
ACGACCACAGCGAGGTGAACTCCCAACTGGACCGGAAGTACTATAGTGATTCTTCTGCGTCGCCCGGTCAAGACGACATC
CGCATGCTGGATGGAACCGTTGCTGGCAATGCTGGGGCTGCGGTCGTCAGCACTGGTACGGCTTCTGAGAATCTGATCCA
GCTCCCACCTCCCACGTCGATATCTTCTGCCAGCATGCAGAACGCCCCGCCCTATGGACCTCTCACCTTGTCGCCGCATA
CTGAAAGAGTTTCCCAGAGCTCGTATGAGCAGCTCAACAATCGGCGCATGTCATCAGACCCATACCGGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62