GenePrediction:GLEAN_2369 Details

Name: GLEAN_2369
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:729657..733196 (+ strand)
Length: 3540
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:729657..729935 (+ strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_140:729997..730494 (+ strand)
Length: 498
Type: CDS
Source: GLEAN
Position: GCSC_140:730611..733196 (+ strand)
Length: 2586
>GLEAN_2369 class=GenePrediction position=GCSC_140:729657..733196 (+ strand)
ATGCCTCTGTCGGGCGCGAGGCGACCCGCAAGCGGGCGTGTGCAGGATGGCGGACGCGCATGGACGGTGGCAACAATGCG
AGGGTATGGCAGTTGGAGGCGCCAAGAGCCGACGCTGGGACTGTTGACCTGGGTCTTTCTCTTGCTGTTGTCGGCAAGCT
GGTTGACGGCTGTGTCGGCAATGCGCAGCGAGCGCATCGTGGAGCTGCGACGGGAGACGGTCAAGATGTTCTACCACGGC
TACGACAACTACATGCAGATTGCGTTTCCGGAAGACGAGGTAAGACCGGGGCAAAGCAAGACTGGTCGGTCGATACAGCG
CTGACGTTGGTTTGCGGTAGCTCCGGCCGGTGTCGTGCGCACCATTGACGCGAGACGCGCAGAACCCGGACAACGTAGCG
CTCAACGACGTTCTGGGCAACTACTCGCTGACGCTGATCGACAGCCTGTCGACGCTGGCGATTCTTGCGTCGGCACCGGC
GGAAGACGGCGACGTGGGACCAAAGGCGCTGCGTGACTTTCAGGATGGAGTGGCAGCTGTGGTGGAGCAGTATGGCGACG
GGCGAGCAGGGCGTACGGGACAGGGCCAGCGCGGGCGAGGGTTCGACGTCGACAGCAAGGTGCAGGTGTTTGAGACGGTG
ATCCGGGGTGTCGGAGGGCTGCTGAGCGGCCATTTGTTTGCGGTGGGCGAGCTGCCGATTGCAGGATACGAGGCAGCAGC
ATGGCCGACGTGGCCAAACGGGCTGCAGTACGATGGACAGCTGCTGCGGCTGGCTCTGGACTTGGCAACGCGGCTGCTGC
CGGCGTTCTACACACCGACCGGGATGCCGTATCCGCGGGTGAACCTGCGGCACGGCATTCCTTTTTACCAGAACTCGCCA
TTGCACGGAATGGGAGGTGGCAGCAGCAACAGGAACAGCAGCAGTAGCAGCAGCAGCGCGACGACGACACGGAGATCACA
GAGACATGCAGTGCAGGGGCGGGCAGCCTGGTGCTGGAGTTCACGGTGCTCAGCCGGCTGACGGGCGACCGACGGTTCGA
ACAATTGGCCAAGCGGGCGTTCTGGGCGGTGTGGTACCGACGAAGCACGATCGGGCTGATCGGAGCGGGCGTGGACGCAG
AGCAGGGCCGGTGGATCGGACACTATTCGGTGATCGGGGCCGGAGCCGACAGCTTCTTCGAGTACGCGCTCAAGTCGCAC
ATTCTGCTGTCGGGTGCCGAGCTGGCCAACGGGACGCAGCTGCAGGCACGGCCGTCATCTTTGCGGTCGGGACGGTCGTG
GCTGGACCCTAACGCCATGTTCCCGCAGCTGAGCGAGGAGGAGAACCGACCGGAAGCGTTTCTGGAAGCGTGGAACCTGG
CACACGCAGCGATCAAGCGGCACCTCTACAGCGACCGGGAGCACCCGCACTACGTCAACGTGAACCTCTGGACAGGATCG
CTGGCGTCGCAGTGGATCGACAGCCTGGGGGCATACTACCCAGGGCTGCTCGTGCTGGCGGGCGAGCTGGAAGAAGCGGT
GGAGACAAACCTGCTGCACACGGCGGTATGGACACGCTATGCGGCACTGCCGGAGCGCTGGTCGATCAAAGATCGCACGG
TGGAGGGTGGCCTGGGCTGGTGGCCGCTGCGGCCGGAGTTTGTCGAGTCGACATACCACATCTACCGGGCCACACGGGAC
CCGTGGTACCTATATGTGGGCGAGATGGTGCAGCGCGACATCTGGCGGCGCTGCTGGACGGCTTGCGGCTGGGCCGGGCT
GCAGAACGTGCTGGATGGCGAGCAGACGGACCGGATGGAGAGCTTCTTTCTGGGCGAGACGGCCAAGTACCTGTATCTGC
TCTTTGACGACCGCCACCCGCTCAACTCGCTCGATGCGGCGTACGTGTTCACGACCGAGGGACACCCGCTGATTCTTCCG
CGACGACGGCGCGACCGGACGGCAAGCACGCCGAAACAGGCCGACCAGCAGATCCCGAGCACGCCGGTGCAGTCGTCGGC
GACGTACAGCGGCACCGAGATCGGGCAATACGACGACAGCGGCTTCACCAACACGTGTCCGGTGCCGCCGAAGCCGTCGC
CGCTGACGGGATCGGCCATCACGGCGCGGACGGACATCTACCACGCGGCTCGGCTGCTGGACCTGCATCTGATCGGGAGC
AGCGGCCTGGTGGACCAGGATGACGGGATCGAAGCGGTGGAACAGACACACATACGCTTGAACAGAAGCGGCAGCACCTT
TTTCCCGTGGACGCTGCCGCCAGCCATGCTTCCGAGCAACGGGACGTGTGCCAAGGTGGTGCAGCCGCTGGAGATGAGCC
TGGAGTTTGCGTCGAATCCACAGGAGAGCGGCGGCAAGGGCTTTGGGCGCGGTGGTGGCAGCGCGTTCAACTTTATGCTG
AGCATGCCGACGCTGGACCGGGTGGCGCCCGACAGGATCCGAGTGCTGACGATCTCGGGGCTGAAGCTAATCTTCCGGCT
GGACGAAGAGCTGGCTGAAAGGACGTGGCGGATCACACGGGTCAACGGACTACCGCTGGGACGCGACGAGTCCATCTTGA
TGGATCGGGCACTGCTGAGCCACATCTCGGACGCGCGGTTCAATCTGGTGCGCGATCCGATTGTGGTGAAGCTGCATCAT
CTGCACTGGGATGGGGGGGAAGAGGGGGAAGATGGAGAGAACGGGACGGCTGATGGAGACAACAGAAAAGAGGATGGCAG
CGGAAATGTGGACAACAAGGAAATGGCAGGCGAACGCGACGGCCTGGCAACTCTGATGCGGTCGTTTTGGCGACAGATTG
TGTCGTCGTTTGACGGCCGACCGCACGTGACTTCTTCTCCAGGCAGCCGTCGAGGGTGGAGCAGCATCAGCAGCAGCATT
GGCAGCAGCATCAGCAGCATCAGCAGCATCAGCAGTCGCAGCAGTGCGAACGGCGCACGACGACCGGCCAACATCCTGCA
CAACGCGACGGGTGTGACGCCGACAGGACTGGGCGCAGCACCGTTGCCACCAGTAGACGTGCCGGCCGGCGCCGTGATGC
CGGCAACAGGACCAGTGCCTACGCAAATGTTGCCGTGGACGACGGTCTTTGCCGGAGGTAGCGGCTGTGATGGGCCGCTA
CCAGAAACGGCAGCACGTGACCACCAGATTTTGCTGCTGCGACGTGGCGGCTGTTCCTTCTCGGAGAAGCTGGCGAACGT
GCCGTCGTTTGCGCCGAGCCGTCGAAGCCTGCAGCTGGTGGTGGTGGTCAGCGACGACGACGACGTGATCGTGACAAACC
CGACGGGCAGTGGCCGCGGCCTGCAGGCCACGTTCTACGACGACGCGGCCGACTTTGTGCGGCCGCTGCTGGACGAGGCC
CAGCTGACGCCCGGCGGACTGCCACGACGACACCAGCTGGCCATGGTCATGGTGGGCGGCGGCGAGGCTGCGTACCGGCG
ACTGGCCGAGGCACGGCAGCTCGGCCTGACGCGACGATACGCCGTCGAGAGCCAGGGCGTGCGCATTCGCAACGTGCTGA
TCGACGATGGCGATGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62