GenePrediction:GLEAN_2370 Details

Name: GLEAN_2370
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:748352..749407 (+ strand)
Length: 1056
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:748352..748975 (+ strand)
Length: 624
Type: CDS
Source: GLEAN
Position: GCSC_140:749027..749407 (+ strand)
Length: 381
>GLEAN_2370 class=GenePrediction position=GCSC_140:748352..749407 (+ strand)
ATGGATCGCCGCAACCGGCCAACGGCCCTGGCCACGCCCACGGCCCTGCCACCGCAGCCGCGCGTCGACGTCGTGGGCGA
CCGGGTCAGCGCCGTGCTGCCGTCGGGTGAATCGGTCGAGGTGTCGCTCTTTGGTGCCACCGTGCTCTCATGGCGCGATG
CGCTCGGTGCCGACCGGCTCTGGCTCAGCGAAGCCGCCGTCCTCGACGGATCCAAGGCTGTGCGCGGTGGCATCCCCGTC
GTCTTCCCCGTCTTCGGCGTCGCCCCGGCCGACACTGCCGCCGCCAAGCTGCCGCAACACGGCCTCGCTCGCACGTCCCG
CTGGGACTTTCTGGGCAAGTCTACGTCCGAGGCCACGTCGGCTCGCCGCGTGACGGCGCCGCCACCTGGCCCTTCGTCTG
CCGCCAAGAAGATGCCTCTGTCCGCCGAAGGTGTCCAGCTCGACTTTGGCCTCTCGGCCGCCTCGGCTGATCCGGCTCTG
CGTACCCTCTGGCCCTACGACTTTGGCCTCATGTACACGGTCACGCTCGAGCCCGACCGGCTGTCGACCAGCATCGTGGT
GACCAATGATGGTGACCGGCCGTTTGACTTTCAGGTCCTGCTGCACACGTATCTGCGCGTTTCGGTGCGTTGTTCTCCCT
CGTTCGCTTCCCCTCTTCCTTTCCTAACTTGTCAGGATATCTCCAAGGTCGAGGTCGCCGGCCTCACCGGCTCGCCCTAT
CTCGACAAAGTCGGCGGTGTCCAGGCCAAGACCGAGGCTGCCGCCACTGTCGCCTTTGTCGGCGAGACCGATCGTGTCTA
TTCGCCTGCCGACGGCGCCTCCGCTCCGGTCGAGGTGCTCGAGGCCGGTGCTCCCCGCTTCTCCGTCGCCCGCGACAACC
TCGCCGACGTCGTCGTTTGGAATCCCTGGACCGACAAGGCCGGCGGGCTAGCCGACTTCGCCCCCAAGTCGGGCTACCAG
AACATGCTCTGCGTCGAGCCGGGTGCCGTGACGGGGTGGCAGACCCTAGAGCCAGGTGAAGCCTTTGAGGGCGCACAGTC
GATAACGGCACATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62