GenePrediction:GLEAN_2371 Details

Name: GLEAN_2371
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:751327..751720 (+ strand)
Length: 394
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:751327..751560 (+ strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_140:751619..751720 (+ strand)
Length: 102
>GLEAN_2371 class=GenePrediction position=GCSC_140:751327..751720 (+ strand)
ATGTCGACCGACCCCAAGAAGCCGGCCGAGGTCGAGGATGAGGCTGAGGACACGGGAAAGACGGCCGAGGACCGCGCCCT
GGCCTCGCTCGACGCCGTCGGCCCCCAGTCCGATGAGAGCACCAAGCATGTCGACCACGAGGCCGTCAGCAAGGCCATGA
AGAACCTGAAGCTCGGCACTGCTGCTGCTGCCACGAAAAAGGTCAAGGTCGATGCTGCCGACGTGGCCCTTCTGGTACGT
CGTAATGCCTGCCTTTCGGTCTTTCTGCCCGTTCGTCCCGCTGACCCGCCAGGTGAACGAGCTCGACTTGACCAAGGCCA
AGGCCACAGACCTGCTGAAAAACCACGATGGCAACGCAGTCTCGGCGCTACGGGCGTTTGTCACTGTGAATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62