GenePrediction:GLEAN_2372 Details

Name: GLEAN_2372
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:754604..756565 (+ strand)
Length: 1962
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:754604..754636 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_140:754830..755363 (+ strand)
Length: 534
Type: CDS
Source: GLEAN
Position: GCSC_140:755429..756565 (+ strand)
Length: 1137
>GLEAN_2372 class=GenePrediction position=GCSC_140:754604..756565 (+ strand)
ATGTCGGGAGAGGACAAGCCATACATGGACATGGTATGTGAGCTGGATACGGGTTGTGGCAATTGCATCAAGTTCCCAGA
GTCTTTTCCCCTCTTTGGCTTCTCTTTTTCTTCCTCTTCTGGTTTTCCCTCCCCTCCTTTCCTCCTCCTATTCTTCCCTA
TCTCTTTTCTCCCCTATCCCTCTGCATTATCCCTCTTCCTCTCTCCTCTCCGCTGACCCTTCCCAGCTCATGTCGGTCGC
CGGCGAGGTCCGGCGATACTCCGGAGAGGTGGCCGAGTTCGTCGACGAAAACTTTGACCGGGCAGCCGATGTTGTGCGGG
ACCACCTCTCGACGGCCACCTGGCTGCCCGAGGCTGTCCGGGCCAACCTTCCGCTGCCACGGCCACCACCACCGCCGCCC
GTGGACGTCATCCCGACTGTCAGCCTGACGTTATATGAGCGCGCACAGGATTGGGTTATGCGCCACCGCATTCTCGTGTC
CTTTCTCGCGCTTACCGTCGGCACTGTGGCTTACCGCAGCGTTCGCCGCGTGCAGTCGAGCCGCAAGTTCCGCCGTGCTC
GGCGGGCCCGCAACGGAGCCCGCTGCGAGGTGGTCGTCATCGCCGCATCGCCGTCACTGCCCGTCACCCAGTCGCTCGCC
CTCGATATGGAGCGACGCGGTTTCATCGTCTATATCATCTGTGGCTCGGCCGAAGACGAACATGCCGTCCGTCAGCTGTC
GCGGCCTGACATTCGGCCGCTGTCCATCGATATCACTGATGTATGTTATTTTTACTTTTTACTTTTTTTCTTTCTTCTTT
CTTTTTCTATTCCCTAACATCTCAGTCCGTCAATGCCGGTGCTGCCCTCGACCGCTTCGCCCTCTACCTCCATGCCCCTC
ATGCCGCCGTGCCGGGCGCCCGCAAGAGCCACCTCACGCTCACGGCCGTCATTATCATCCCGTCGCTCAACTACCAGACG
TCGCCCATCGCCACCATCCCGCCCTCCAACTTTGCCGACCTCTTCAACACTCACCTCTTGCATCCCATCCTCTCCATACA
GGCCTTCCTGCCACTCTTGACGGCACGCACAGCCCTGCAGCCGGGCGAGAAGCCGCCACCGTCACTGCTGTCTACCGCAT
CTTCCATGGCTCTGGCCAACATTGGCGGTGCCAAGAACAAGACCAAAAACACCAGCAAAGCCGGCGAGGCTGATGACGCC
TCCAAGCCGCCGTCGGACCGCATCCCCCCGCCGCCCAAGGTACTTGTTTTTTCGCCGTCCATCATCTCGTCGGTGAACCC
GCCGTTCCACGCGCCCGAGTCGACCGTCTGCTCGGCGCTGACGGCCTTTACGGAGGTCTTGGCGGCCGAGCTGCGGCCGT
TGGGCATTCCGGTCACGCACATCCAGCTGGGCACCTTTGACTTCTCCGGCTTTGCGCCACCGCCCCGCAGCGCCATGGCC
CAGCAGCTCAGCAACACACGCATCCCGCCGCCTGCTGTCGTGGAGACGCTGGCCTGGTCAGAGCCGGCTCGCCACGTCTA
CGGTCGCAACTACACGGCCCAGAGCACAACGGCCCTGGGCAGCGGCCGGGCCATTCACGGGCTGCGCGGCACGGCTATGC
GCGACCTGCATCACGCTGTCTTTGACGTGCTCGACGGCTCCAACACCGGCAGCGTTGTGCGTGTCGGTCTCGGCGCCAAC
TTGTACGGCTTCGTCGGCAACTTCATGCCGCGCGGCTTGGTGGCCTGGATGATGGGCGTGCGCAAGGTCGATGGCCTGGA
GAGCCTGTACAGCGCCCCGGTACCACCTGCGTCCTCGTCGTCCGCGCCTACACCGAATGCGTCGGTCCTGTCGACGTCGA
GCGAGAGCTCCGGGCCGCCGATTCGCCGCAGCAACAGCACCAGCAAGAACTCGGAAACAACGGCTGGCTTTGTGGCCGTC
GCCGCTGACGAGGCCGTTGCTGACTCGCATATCTGGCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62