GenePrediction:GLEAN_2373 Details

Name: GLEAN_2373
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:762876..764875 (+ strand)
Length: 2000
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:762876..763135 (+ strand)
Length: 260
Type: CDS
Source: GLEAN
Position: GCSC_140:763183..764875 (+ strand)
Length: 1693
>GLEAN_2373 class=GenePrediction position=GCSC_140:762876..764875 (+ strand)
ATGCCCCTACCGGCTGTCACGCGGCGATGGCCAGCGCCAGGTGCCCAGATCTGCCGGCGATGTGCGCGTCAGCTGTTTCT
GGAGCCGCAACGGCGCAACGTCACGGGCAAGTCGTTTGCCAAGTACGGGCCCAAGTACCAGGCCAAGATCGACCAGGCAG
ACGCGGAGTGGGAGACGCGGGCGGCCCTGATCGAAGGCGGGGGGGCCAAGGCGATGTGGGACATCTTTGAGGAGCGCGGC
TATGTAAAGGATGTTGCAGGGTGAGTATCGGGTTCCGTCCTGTTCTGGCTCCTCTAACTCGAGACAGCAACCGGGAGGAC
ATCCGGAAGCTGCTGACGCAGAAGCGCATCGGGGCATACGTGGGCATCGACCCGACGGCGCCGTCGATGCACGTGGGCCA
CCTGCTGCCGCTGATGCCGCTCTTCTGGATGTACATGCACGGCTACCGGGCGGTGACGCTGCTGGGCGGCGCCACGGGCA
AGATTGGCGACCCGACAGACCGGCTGCAGAGCCGGGCCGAGCTGAAGAACGCCACGGTGGCCATGAACATGGTCAAGATG
CACTACCAGCTCAAGAAGCTGTGGGTCAACGTGGAGGCGCAGGCGCGCCGCTACGGCTACGAGAAGACGTGGGCCTGGCG
TCGCGGCGTGCTGCAGAACGGTCACTGGTGGAACAAGCTGCCGATGCTCGAGATCCTGCAGCGTCTGGGCGCCGGCCTGC
GCATCGGTCCCATGCTCTCGCGCGACACCGTCCGCCGCAAGCTGACCGAGGGCGACGGCATGTCCTTTGCCGAGTTCTCC
TACCCGCTCATGCAGGCCTGGGACTGGTGGCACATGTACATCAGCCAGGGCATCCAGATGCAGATCGGCGGCTCCGACCA
GTACGGCAACATCGTCACCGGCGCCGACGCCTTCAAAATCATCCGCGCCTCCGAACCAAATCCGGCCTTGAAGCTGTCCT
CCGGCCTCTTGCACGATCCTGTCGGTTTCACCGTCCCCCTCCTCACCGACAGCTCCGGTGCCAAGTTCGGCAAGTCCGCT
GGAAACGCCATCTGGCTCGACCGCTTCCAGACTCCCACCTTTGATCTCTACGGCTACTTCGTCCGCCGCCCCGACGCCGA
CGTCGAGGCCCTGCTGCGCCTCTTCACCTTCATCCCACTCGACCGTATCACCGCCCTGATGGAGGACCACACCGTCGATC
CTGCCCGCCGTCTCGCCCAGCATACCCTCGCCTTCGAGGTCGTCGCTCTCGTTCACGGCCTCGAGCTCGCCACCGAAGCC
CGCGACCGCCATCGGGCCATGTACGATAAGAAAAAGCTGACTAATCAAAACGACGGTGACGACGCCATCATGGCCACCAC
CTCCGCCACCACTGTGGCCACAGACGCATACCCCCGTACGCTCAACCAGGCGCCTCAGGTTGACCTGCAGCTGCCGGCGG
CGCTCTTCCGCGCCGGCAAGGTGGCCCGCATCCTGTACGCGGCCGGCATGGTCAAGAGCGTGTCCGAGGGCAACCGGCTG
GCCATCCAGAAGGGCGCCTACGTCGGGGCGTCACCCGGCCAGACAGCTCACCACAACAAGGGCATGCCGCTGACCCAGGT
CGACTTCACGCCCGTGCACCTCTGGTACCCTGAGGACACTAAGAACTTTATCATCGACGAAAAGTACATGGTGCTGCGCA
AGGGCCAGCACAATGTGCGCGTCATCGAGATCGTCAGCGACGAGGAGTGGGAGGCGTCCGGTCGCACGTATCCGGGTCAG
CCATATACCGGCAGGGTGCGCGAGCTGCGCGAGCAACTCAAGATGCTCAAGGCCGGCCTCAGCCAGATCGACGGGAAGAA
CGGGAAGAACGGGAAGAACGGGAAGGACGGGAAGAGCGGTGGTGATGGTGATGGTGGTGACGACCAAGGCAAATTGGTCT
TCCCCGATGAGAAGACAGAACAGGTGCGCGCCCTCGAGGAGGACATTCGGCAAGAGCTGTTGCGTCAGGACGGGAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62