GenePrediction:GLEAN_2374 Details

Name: GLEAN_2374
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:769627..770781 (+ strand)
Length: 1155
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:769627..769804 (+ strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_140:769878..770195 (+ strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_140:770246..770781 (+ strand)
Length: 536
>GLEAN_2374 class=GenePrediction position=GCSC_140:769627..770781 (+ strand)
ATGTCCTATTCCCGTCTCTACCATCTCTCACCCTTCTTCCAGGGCCCGGACGGACTGGCCGTCAGCAACCTGCCCGATGT
ACAACCTGCACCAGACCAATATCTCATCGCCGTCCACGCCGCAGCGGCCAATTTCTTTGACATCTTGCAAATACAGGGAA
AGTACCAGAACCAACCACGTACGATTTGCACACCCATTTTTCTGTCCCTTTTCTCCTTCTGCTCACATCGCTCAACTTGC
TTCTGTTCTAGCCTTCCCCTGGGTCGCCGGTGCCGAGTTTGCTGGCGTCGTGCTTGCGACACCGACTGGCAGTCAGCTGG
TAAAGCCTCGCTTCGCCGTAGGCGACCGCGTCTTTGGAGCCAGCCAGGGCGCCTACGCCACCAAGGTGTGTGCCACCGAG
AGTCAGCTGTGCCCCGTGCCGACCGGCTGGTCGTTCAGCGAGGCGGCCGGCCTGTTCGTCACGGCACCGACGAGCTATGC
CGCGCTCGTGATCCGGGCCAACATCCGTGCTGGCGACTACGTGCTGGTGCATGCGGCTGCTGGCGGCGTCGGCCTCGCGG
CCGTGCAGGGTGAGTGAGGAGCCGGTTGACTTTCGAGAGATCCTGCTCACAACGTGCAGTCGCCAAGGCGTTTGGGGCCA
CCGTCATCGCCACGGCCGGCACCGCACGCAAGCTGGCCGTGGCGCAGGCGTTTGGAGCCGACCACGTGATCGACTACAAG
GCGGAGGCCAACTGGCCCGACGCCGTGCGCAAGCTGACGCCCAATGGCCGCGGCGTCGACATCGTGTTTGACCCCGTCGG
GCTGGTCGACCGCAGCACCAAGTGCACGGCCTGGAACGGGCGCATCCTCATCGTCGGCTTTGCGGCCGGCAAGATCGAAG
CCGTCGCCATGAACAAGGTGCTGCTCAAGAACATCAGCCTCGTCGGCATCCACTGGGGCGCCTACACGCGCAACGAGCCC
GACCAGATCCCCGCCGTCTGGGAAGGCCTGCGCTGGCTGATCGACCGCGGCGCCTTCCGGCCGACCGTTTTCACCGACGG
CGAGCCGTTTGTCGGCCTTGATCACGTTCCCGCCACGCTCAAGGCGCTCGGCGGTCGCGAGACCTGGGGTAAGGTCGTCG
TGGAGATCCCACAGGAGGCAGAGAGCAAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62