GenePrediction:GLEAN_2375 Details

Name: GLEAN_2375
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:771816..772687 (+ strand)
Length: 872
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:771816..771852 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_140:771969..771984 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_140:772213..772308 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_140:772387..772687 (+ strand)
Length: 301
>GLEAN_2375 class=GenePrediction position=GCSC_140:771816..772687 (+ strand)
ATGACACTCAAGGAGGAGTTCGCTACTAGAAATTTCAGTAAGTATTACTGTCCGATAGCGGCGAGCAGATGCGCCAGACG
CTAGAGAGGGAATGCGAAAGACCACGGCCGAAACGAAACGAACAGTTTTGCTGACAATATGGTATCATCATAGGCATCTA
TGGACAATGGTACGTTTACCCCTCAAGAACACCCCGCGCGCCGCCACGGTGCTTCTCGTGCTCGTGATGGACACGAGTAC
ATGAGCTGCGGCGGTGCTTGTCGAGCTCCGTATGGCAGTATACCACGCCCTCTTTGACCGGCCAGCCGGCGCGCGCAATG
CCGGAAGACTGCGCAGGGGGGGGGTTGCGGAATATCCAAGCTTGATGAGGCAAGATGCTGACCGCTGTGCAACTTAGGCT
TGGCATCCTGTCCATGATCCTGTGTTTTGCGCTGGGTATTGCCAACATCTTTACGTTCCGAGTTGTCACCATTATCTTCA
GTGTCATATGCCTGTACGCTCCCAGACATCTGTCGCCCTGTCTCTCCACACTTTTGGCTGTGCGTTTCGCTAACGTTTTC
TACTTTCCCAGCCTCTCCTCGTTTGTCATCCTCTTTATCGAGGTTCCGCTTCTGATGCGCATCTGCCCAACATCGTCGAC
CTTTGATTCCGCTATTCGCCGTATCTCGACAAACTACATGCGCGCAGCCGCCTACGGAGCTATGGCGGCGATCCAGTGGG
TGAGCATAGTTGGTGGCAGTTCTAGCTTGATTGCCGCTGCTGTGTTCCTTACCATCACGGCCTTGTGCTACGTCCTGGCC
GCCGTGAAGGGCCAGGACTTTGTTGGCAGCAAGACGCTGGGTGGTGCCGGTGTGGCACAGATGATCGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62