GenePrediction:GLEAN_2376 Details

Name: GLEAN_2376
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:773466..774832 (+ strand)
Length: 1367
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:773466..773544 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_140:773609..774307 (+ strand)
Length: 699
Type: CDS
Source: GLEAN
Position: GCSC_140:774360..774832 (+ strand)
Length: 473
>GLEAN_2376 class=GenePrediction position=GCSC_140:773466..774832 (+ strand)
ATGGAGGTTGCTAACCCCCGCCGCATACTCGCAGTCTCTCTGGTTGAGTCGCAGGAGCACTTGTCTACAGTCATAAAAGG
TGCCTCATTCGTCGTCCTGGAAGCAGGGAGAGAGTTGGTGGTATACTGACTCGCCACGCCTAGACCTCACTGGCGCGTAC
CCAGAGCGCTCGGCTGGAACGGGCTCATTGGCTGGGACAACGCAAGAACTGTTTCTAGACACGCCATACTACTCGGCGCG
AGTGCCTGTGTGGCTTGACCTGATTGGAGCTGAGGAGCAGGCAGAGCAGGCAGAGCCGGCAGAGGATGTTCCAGCCGTAG
GAGAGCCGGCAAAGGCTTCAGAAGAAGTCCCGGCACAAGATCATGTCACAAATGCGAAAGGGGACGTTGACGGTACTGCT
GGTTCTGGCGCTGCCGCCGCCGCCTCTCCGATGACGCCTCGGCAATGGGCCGACGCTTTCCTGGAAGAGGAAGCGCGCGA
GGTGAGAGCAGCACTGGGTGGTGTGGTAGTGGTATTGGAGATGAATAGCAGCACGGGTGCAGAGGGTGGGCCGACAAGGC
CAAATCGCGTCGAGCAGCAGCGTGATCTCATCAGACATGTTGGCCGTCTGATCCAAGAGGGATTGGGCGTGGCGGCCCTT
GACGACAATGACGGAGAGGAGGCGCGGGAGTATTACGATGACTCCTGGGACGGCGTCGGACTGGTGGTCGGCATCGCGCC
TCGGGGCACTGGTCCGCCGCTGGCCGAGGACCTGCTGGCCGAGTGGGAAGATGCCTGCATAGCAGCAGGCCTGGAGTTTG
TGCTGGTAGCCTCGGGTCAGGCAGCGACGAATGAGTTTGGCGGTAGGTTTCTGTTCTTCTTCTCTTGATGGCAGTAATCT
TACGGCGTATCCAGAGAAAACGGGCATTCCTCGCGTGCTAGAAGCACTACAGGCCAACGACTGGAACCAGGCAGACGGAC
TGGGCCTGGATGGTGATGGCGTTGACGATGGCGATTTCGAGTTTGGGGCTTTTCAAGATTCGGACCGCGAGCTGCATCGT
ATTGTCAACCGCGGTGATGGTGACGGGAGTCACGACGACGGCGACGAGCTTTTTGACCCCGAGAGTCTCGACTTTGGCTT
TGACCGGACCGATTTTGCCGGCCTACGTGAGGCTATCTGGCGGCAGAGCACCAGGACTGTCGAGGGTGGTGCCGGGGACC
AGGATGCTGCCGGGGCCGTGGAGGACGAGGAAGACGACGGCGTGCAATCAGTCGAGCGCATGATGCAGAAGCTGCTGGCA
GCGCGAGACCTGGGTGCAGGGTTGCCACCAGACCAGCGGCGCCGTTTGGCGGCACGGGCTGTGGGAGAGGTGATGCGGGA
GCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62