GenePrediction:GLEAN_2379 Details

Name: GLEAN_2379
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:783420..784327 (+ strand)
Length: 908
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:783420..783565 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_140:783634..784327 (+ strand)
Length: 694
>GLEAN_2379 class=GenePrediction position=GCSC_140:783420..784327 (+ strand)
ATGATGGAATACGCACAATATCAACCGCAACCGCAGAACGGTCACGTCCAGAATATTCAGGCCGCATACCCCAACGCTGC
GGCTGCTAACGGCATCTCGCCGCCCCAGCACCAATCTTCGACTGCGCGGAGCCAAGATCCCAACATGTATCAGCCATACA
TGCCCCAGCAGGACATGCAGTATGTCCAGGCTGCTGCCATGGCTGCGACGGCAGCCGCGTCTGGTGCGGAGCCTACCCCT
ACGGCATGTCGGCGGACCCGGCCATGCAGCAGAACTCTCCGCGGCTGGGCTCAAAAAAGGAACAGCGCAATCCTCGGTCC
CCTCCGCTGAACAACATCAATGCCCAGGGCCGTCGGCTGAGCCAGGTCACCAGTCCCGGCCTGCCAAACGCTCAGGCTAT
TCTGAACCACAACGCGTCAAGAGCAGCAGGCGTGCCTTCAACCCTCCCACCGCAGCAACAGATCCACGCACCCCAGTCAC
CCGAGCTTGCAGCTGCTCCTGCTGAGGAGTCGCCGCTGTACGTCAATGCGAAGCAGTTCCACCGGATCCTCAAACGGAGA
GTAGCCAGACAGCGTCTCGAGGAGGCCTTGCGGTTGACCTCTAAGGGCCGGAAACCCTACCTTCACGAGTCGCGACATAA
CCATGCGATGCGGCGGCCCCGTGGTCCGGGCGGCCGCTTCTTGACTGCCGACGAGGTGGCAGCGATGGAAAGGAAGGACG
GCCAGCTGGAGGGTGACATCAAAGAAGGAAGTGATGCTGGTACGTCGGAGCCTCCGGCTGAGGTCGCGACACCATCTTCT
GGCAAAAAGCGCAAAACAGAGAGCGGCACGGTGCAGCTCGCAAAAAAGGCCAAGGCGGAACAGCCGATAGCAGAGGAAGA
CGAGGAGGACGGTGAGGATGATGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62