GenePrediction:GLEAN_237 Details

Name: GLEAN_237
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:468612..469344 (+ strand)
Length: 733
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:468612..468697 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_167:468771..468987 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_167:469045..469344 (+ strand)
Length: 300
>GLEAN_237 class=GenePrediction position=GCSC_167:468612..469344 (+ strand)
ATGTCGACCGCCACGCAGTCCCGCATCTTGCCGCCGCCGGGCAATGGCCTGCCGGCCAAGGTGGTGCCTATTGCGCCGAA
TCAAACGTACGTCCCTCCTTTCTCTTCACGCCTGCTTCTCTCCTCTGCTCCCGTCTGCACTCTATTAACCCTGGCACAGC
CTCTACGTGCGGAACCTGCCGTCGGCCAAGATCAAGAAGGAGGACCTGCGCATGGCGCTGTACCTTCTGTTCTCCACCTA
CGGCCCCGTGCTCGACGTCGTGGCGCTCAAGACGATGAAGATGCGAGGACAGGCGCACATTGTCTTTCGCGACATCCAGG
CGGCAACACAAGCTGCCCGCTCGCTCGATGGCTTCTCCTTTTTCGGACAGGACATGGTACGGTTCACCTTTGTACAATTG
TCTGTCCCATCGATCGCTGACAGCCGGTTCTAGAAAGTCACATATGCCAAGTCCAAATCCAACGTGATCGCCAGGCTAGA
CGGCACCTTTGAGCCGCCCACGGCCGCCCAGACTGTCGAAGTCACCGATCTCCAGCAGAGCATCTTCAACGCCCCGGCGC
CGGGCTCGGCTGCTACGCCTCCCCCTGTCGTTCCCAAGCCGGCTGATGCACCAGGCGGAACAAAGGCAGACGCCGAAGCC
GAAGCAGCTCGCGGCCAGAAGCGGACGCGTGACGAGGAGGACGAGGAGGAGGACGACGACAGCGATGTGGCCAGGGGAGG
AAGACAGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62