GenePrediction:GLEAN_2380 Details

Name: GLEAN_2380
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:785668..786188 (+ strand)
Length: 521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:785668..785717 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_140:785776..785923 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_140:785984..786086 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_140:786148..786188 (+ strand)
Length: 41
>GLEAN_2380 class=GenePrediction position=GCSC_140:785668..786188 (+ strand)
ATGGTGACAATTCGCACCGACGAGAGGAGACAAGGGGAGCTGCGAGGCGGGTTAGTGTGCACGTCTGTGCCGCGTCGCGG
GCTACTTGCTGACCGCTCGTCCGCACAGCTTCTTCAAGACTCTGATTGACACGACGGTCACGGTCGAACTCAAGAACGAT
ATCCAAATCCGTGGCACGCTCAAGAGCGTGGACCAGTACCTCAACATTAAGCTCGACGATATCACCGTCGTCGAGGAGAT
CAAGTACCCCCACATGGTGAGCTTGCATTTCTGTGTCCTAGCCAGGTCCTGTCGTCTGCTGACCGCCTCTGCCCAGAGCG
CCGTCAAGAATGTCTTTATCCGCGGCAGCGTCGTGCGGTATGTGCACCTGCCGGCCGCTGCGGTAGATGTATCCTTGCTG
GAGGATGCCACCCGAAGAGGTAAGTGCTGGGCTTTTATTGTCGTTGTCATGTCGCCAGAGCTGATAATTCCTCTCTGCAG
AGGCGGCCAACAATGCCCCCAAGACTGCAGGCGCAAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62