GenePrediction:GLEAN_2381 Details

Name: GLEAN_2381
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:789891..792403 (+ strand)
Length: 2513
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:789891..790026 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_140:790101..790124 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_140:790208..790882 (+ strand)
Length: 675
Type: CDS
Source: GLEAN
Position: GCSC_140:790932..792078 (+ strand)
Length: 1147
Type: CDS
Source: GLEAN
Position: GCSC_140:792133..792403 (+ strand)
Length: 271
>GLEAN_2381 class=GenePrediction position=GCSC_140:789891..792403 (+ strand)
ATGGCATCCACGGCTGATCCTCTCAGCGTGGTGGCCGATGGCCTCATGGCGAAGAACACCCGGTCGGTGATTCGCGTCGT
CATTCTGTTCCTCATCGCAGCTGCCGCCGTGGCCAGCCGTCTCTTCTCGGTCATCCGTGCGTTGTGCCGTGCAATTGCAA
TGCACCCCGTCTCTCCAACCCGGCTCCTCGCTAACATCGTTCTTCTGCAGGATTCGAGAGCATTATCCACGAATGTTCGT
TCTGCAGCCTTTTGACTGCGCCTCGCTCTCGTGTGCGCCGGTCCTCCTCTGGATCACTCTGCTAACCCTGCTTCTAGTCG
ATCCCTGGTTCAACTTCCGCGCCACAAAGTACCTTGTCGCCAATGGCTTCTATAGCTTCTGGGACTGGTTTGATGACCGC
ACCTGGCATCCTCTCGGCCGTGTCACCGGCGGCACCCTCTACCCCGGCCTTATGGTCACCAGCGGCGCCATCTATCACGC
CCTCCGCGCTCTGACTATCCCGGTCGACATCCGCAACATCTGCGTCCTGCTTGCGCCGGCCTTCTCCGGCCTGACCGCGT
ACTCGGCCTACCTGCTGACCAACGAGCTGACCACATCGCCCTCGGCCGGCCTGCTTGCTGCTGCCTTTATGGGAATTTCC
CCCGGCTATATCTCGCGGTCTGTTGCTGGCAGCTACGACAATGAGGCCATTGCTATCTTCCTGCTGGTCTTTACCTTCTT
CCTCTGGATCAAGGCCCTGAAGCTGGGCTCCATGCTCTGGGGCGCCCTTTGCGCCGTCTTCTACGGTTACATGGTGGCTT
CGTGGGGTGGCTATGCTTTTATCACCTGTCTGCTGCCGCTCCATGCTTTTGTCCTGATCTGCATGGGCCGTTACAGTACC
CGCCTCTACGTGGCTTACACCACGTGGTACGCCCTCGGAACATTGGCCAGCATGCAGATTCCGTTCGTTGGCTTCCTCCC
GGTGCGAACCAGCGAGCACATGCCGGCACTCGGTACGGACCCTCTTCTCTGTCCCCACCTAATCTTACTGACCATCTACA
GGCATCTTCGGCTTCCTTCAGCTCCTGGCCCTCCTCGACTACGTACGGTCGGCTGTTCCGAGCCGGCAATTCCAGACCTT
TCTCCTGCTCTCAGCCGGAAGCGCCTTCAGCATTGGTCTTATTGGTCTGGTCATCGCCACAAGCGCTGGCGTAATTGCTC
CTTGGGGTGGCCGTTTCTACTCCCTCTGGGACACGAGCTACGCCAAGATCCACATTCCCATCATCGCCTCTGTATCGGAG
CATCAGCCTACTGCGTGGCCCGCCTTTTTCTTCGACCTCAACTTCCTCATTTGGCTGTTCCCTGCCGGCGTGTACCTCTG
CTTCCAGAACCTAGCGGACGAGCACGTCTTCATCGTGGTCTACGCTCTGTTCGGCAGCTACTTCGCTGGTGTCATGGTGC
GTCTGATGCTGACGTTGACGCCTGTTGTGTGCGTGGCTGCGGCTATGGCGGTGTCCTCACTACTCGACTCCTACCTCGTT
CTCGAGTCGCCCAACTCTGTTGCTGCCGCGGCCGCGGAGGAGGCTGCGGAGAAGAAGTCGGTCAAGAGCGCCGGCCTGAA
GTCGACGTCTAAGCCGGTTGTCGGCATCTACTCGCTCCTGTCCAAGGGTCTGATTACATCCGCCATGACAGTCTACCTTC
TCCTGTTTGTGGCGCACTGCACGTGGGTGACGTCCAACGCATACTCGTCGCCATCCGTGGTTCTGGCGAGCCGCATGCCC
GACGGCAGCCAGCACATCATCGACGACTACCGCGAGGCGTACCAGTGGCTGCGGCAAAACACGGAGGAGGACGCCAAGAT
CATGTCCTGGTGGGACTACGGCTACCAGATCGGAGGTATGGCGGATCGTCCAACGCTGGTGGACAACAATACTTGGAACA
ACACGCACATCGCGACGGTTGGCAAGGCCATGAGCTCGCGCGAGGAGGTCAGCTACCCGATCATGCGGCAGCACGAGGTC
GACTATGTCCTCGTGGTCTTTGGCGGTCTGCTGGGCTACTCGGGTGACGACATCAACAAGTTCCTGTGGATGGTGCGCAT
TGCCGAGGGCATCTGGCCCGACGAGGTGAAGGAGCGGGAATTCTTCACTCCCCGTGGCGAGTACCGGGTAGACGACCAGG
CCACGGACACCATGAAGAACAGTCTGATGTGAGTTGCCTCCGTCTATTGCTTATCTAGAAGCGAATGACTAACAAACATC
AGGTACAAAATGTCGTACTACAACTACCAGTCAATGTTCCCTCCTGGCCAGGCTCAGGATCGCGTGCGTGGCTCCCGTCT
GCCCGAGAAGGGCCCGACACTGAACACGCTGGACGAGGCCTTCACCAGCGAGAATTGGATCATCCGTATCTACAAGGTCA
AGGACCTGGACAACGTTGGCCGGGACCACGGAGCCGTGGCGTCCTTCGAGCAGGGGCACAAGAAGAAGAAGTCATTGAGA
CGCAAGGGTCCCCGGACCTTGCGCTTGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62