GenePrediction:GLEAN_2382 Details

Name: GLEAN_2382
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:795753..796649 (+ strand)
Length: 897
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:795753..795948 (+ strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_140:796126..796649 (+ strand)
Length: 524
>GLEAN_2382 class=GenePrediction position=GCSC_140:795753..796649 (+ strand)
ATGGACACAGATATTCTAAACGCATCACATAATGATGACCGCGATGCCGAGCTTGATGCTTGGTTGGCGGGGAAAACACC
GTTCCAGCAGGACGATGGGATCAGTTACAGTGAGCACAGCCAGTTTGCGACTAACTGCATGGGAGAGAGCATCCCTCCTT
ACAACTTTGATCTCTTTTCGGAACGGGCGCATAGCCGTGAGCCGTCGCCTTTTCCGCCATTCAGAGACGATAGCGACAGT
CAAACAGCGAATGCTGCAGATGAGAGAATGAGATACAGCAACAGTAGCAAGCGCGGAAGTAGCAGCACTATCAGCAGCAG
CGACAGAAGCATTGACGCGATCATTCCAGATTACAGTTTTGATCTCTTCTCAGAAGTGACGAACCGATGGAACCCAGACT
ACAACTATGACAGCGATAGCGGCAGCTACGAAGCAGAGCAAGAGAACAGCATCACCCCCAAAGGTAAAGCTGTGTACCAA
AACAGTGTTGACGAAAACGTGAATGTGTACCGTGGCACCTACACACCCACCAAATACATCGAGACTGCTGGCGAGAAGGA
GAACACCAGCTTTGCGGGCGGACGTCAGAGGAAGGCGAGAATTTCCTCGCGAAAATCTGCGGCTGCCAACAGCAAGTGGA
TTGAAGAGAGAAAGACGGCAGATTATGCATCTCACAATCGCAGAAGCCGCTCGAAGCTTTCTTCACGTAACCAGAATGCT
GGTTGGAAGGCACATCCATCGTTTGAGATCGAGGAATGCCTGGACGATGGCGACAGCAGGACAATGCGCCACATTGTCGA
TTGCGAGGTGATCTCGAATCCGGATTCGATTTCTGAGTGCGGCCGATCAGATTGGTCAAACCGTGCTGGCATTGGACACC
TCCGGTCCCCCCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62