GenePrediction:GLEAN_2383 Details

Name: GLEAN_2383
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:807870..809723 (+ strand)
Length: 1854
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:807870..807976 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_140:808050..808203 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_140:808273..808407 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_140:808473..809723 (+ strand)
Length: 1251
>GLEAN_2383 class=GenePrediction position=GCSC_140:807870..809723 (+ strand)
ATGGCTTCACTCGCCTCTGTCCAGCTTGGCCTGCTTGGGTCCGGCGCCCATAGTTTCCGCCGTTCCTCGCTGTCTGTGGT
CGCCTCGTCCATCAGAGCACTGAATCGGTATATCAAGAAGATGATGCGTCCCAGCCTCTGTCGACGGATCGCCACATCCG
TTACCTGCAGCTACAGCCAGCCAGTCGTCCGGGAGACCCGCTCGTGTGCACGGCGTCCGCCTGTCTGAGGGCCCGATTTA
CGAGGCCGTCTCCTATGTCTGGGGCAGCAGCCAGAAGCCAGCGCGGATCTCATGCGATGGCAGCGATCTGGCCATCACGG
CCAACATTGACGCCGTGCTGCGCCGCCTGCGTCGTCCCGACGTTGCCCGCAACATCTGAGCCGACTCCATCTGCATCGAT
CAGGGCGAGCCGGTCGAACGCGGCTACCAGGTCGCCATGATGGGCGACATCTACCGCCACGCTGCCGCCACCGTCATCGT
GCTGGGCACCGATCCGTCTGGCCATACACCTCGCCTGGCTGCGCTCGTGGCCGATCTCGTCGCCCGAATTCACGCTGACT
AGGCCGCCCTCGGCATCACGCCGCCGATGATCCTCTCGAGCAGGATCCCCGCTGGCCGTCCTACACGGCCCTCTTCGACA
GCCCCTGGTTTGATCGCGTCTGGACGGCCCAGGAGTCTGCCCTCAGCCGCAAACCGCTCATCCTCTGGGGCGACACCCAA
ATCGCCTGGGCCGACATCATCGGCGTCCACCGCTGGCTCGTCATGCATGCCCAGCGCATCTGGTTCCGACACCGGCTCAT
GCTCAACGACGTCCACGAACTCAGCTTCTGGCGGCCCCTCTGGCACATGCCCAACTCTGTCGAGCTGCTCTGCCGTGCCA
AGACGCTCGACTGCAGCGACGACCGTGACCGTATCTTTGCCTTTCTTAGCTCCGCCAAGGCTTACGTCGTCGTTGGTGGT
GACGGTGAGGGCGTCGGCTCCGATAAGGGTACCCTCAATACCCGGACCAACTACCGGAAGCCCTTTCGCGAGGTCTATCG
CGACTTTGCCGCCGACTGGCTGCTCAAGACCGGAAACCTCTGTCTCCTATCTGCCGTCGAGCACACGTCCGACACGTTTG
CCGACCCTATCGTCCCAACGTGGGCCCCTCGCTGGGACGTTTGTCCGACCGGCAGCAGCTACGGCCTCTTCGACCCGGGC
TGCAATGCTTCCAACGGTCTTGGTGCCGTTCGCCCCGTGCTAGACTCGCAGACCAAGCAGCCTAAGCTCCGCGGCATCGT
CTGCGACACTGTCGTCCGGTGCTGGCCCCGCCGCTCAGCCTCGCCCACCGGCGCAGACGTCCTGACCGCTGCTTGGAAGT
ACCTCTCCTCTGACGCTGCCCCGTTCGCCTACGAGGACCGCTCGCAGCTCCAGGCTTTTGCCCAGCTGCTCTGCCGCCAG
AAGTACCACGAAACCGGGGCTCCAGACGAGTTGCATGCCGACGAGGCAGCTTTTGCCCCAGCTATGTGTCGCGCGACCGG
CTGCTTTGGTGATGTCAATGAAGCCTCGCTTGAGACATCCACCCAGGTCGGCCGCATTGAAGACTTTCTCATCAAGACGG
GCATCTGGGCTGTCCGCCGACGGCTTGTCCTCACCCATGATGGCCGCTATGTCCTGGCCTCGCGGGTTGCACAGGAAGGG
GACAAATTGTGCGTGTTGGCCGGCATGAAGGTGCCCGTCATCCTCAGAAAAGAAGAGCAGCAGGACTGCTGCAAGCTGGT
CGGCGAGGCCTTTGTGCTCGGCATGATGAATGGAGAGGCTGTGGACAGAGCTTTGAAATGTGGGACCGCGACTGAGGACA
TCATTCTCTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62