GenePrediction:GLEAN_238 Details

Name: GLEAN_238
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:471055..473378 (+ strand)
Length: 2324
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:471055..471736 (+ strand)
Length: 682
Type: CDS
Source: GLEAN
Position: GCSC_167:471789..473137 (+ strand)
Length: 1349
Type: CDS
Source: GLEAN
Position: GCSC_167:473208..473378 (+ strand)
Length: 171
>GLEAN_238 class=GenePrediction position=GCSC_167:471055..473378 (+ strand)
ATGAACGTTAGGGACCCCTTCGGTCTACACAGAAATCCGACCTTTGGCATTCTTCGCGCCACCGCAAACCAGGCCGCACG
CGAGATCAAGCACAGGGCCATCGAGGCCGGCGCCCATGCGCTAGAAAGAGGAAAGCAAGCCAGAGAGGCCGTTGAGACCG
CTGTCGAGACCGCCTTAGAAAGTGCATCGGCCGTAACGGACGACATGGCATTCTCAGTGCCCCGGAATGTGCCATCGTTT
AACAACCCACAACGGATAGCAGAGGACCAGCTGTGGGGAGCAGCCACGGGGAAGACGAACACCGGCAACCGCGGTGGCAG
AAACAACATCCTGGACGCGGTCGGTGGCCTGTTCGAATCCGGGATCCCCGGTCGGAGCTCGCAGACGCTGCCCATGTACA
AGGACAAGCCGTATGGCTATCTGCCCTCGGAACGGGCACGGCCTGTGTACCGGCGAAAGCGGGTGCTAGGGCTGGTGTTC
TTCGTCTTCCTTGCCGCGCTGTACTACCTCGGCTGGTTTGACGCACACAAGGACCGAGTGCCAAGGGTGCCGCTGCCGTC
GTGGGACTGGCTGAATGGCAAGGACGAGAAGGCACACAGCCGGGCCGACTGGCTGGACCGCCGAGAGCGCGTGGTGGAGG
CATTCGAGCTAAGCTGGGATGCCTACGAGCGCTACGCCTGGGGTACGTCCGACCGGTTTTCACTCTGCTCCGGTAGTGCT
AACGAAATGCGCAGGCTATGACGAGTTCCACCCCGATTCCAAGCTAGGAAAGCAGATGGCCCCCCATGGCCTCGGCTGGA
TCATCATCGACTCGCTGGACACGCTCATGCTGATGAACCTGACGTCACGGCTGGTGCATGCTCGCGAATGGGTCGCGAAT
AAGTTGACGTGGGACCAGGACCAGGATATCAACACGTTTGAGACGACGATCCGCATGATGGGTGGCCTGCTGTCAGCTCA
CTACCTGGCAAACGAATATCCACATCTGGCGAAGCTCAACGACATCCAGCTGGCCGAGACGGGCGGCGAGGACCTGTATC
TGGAAAAGGCTAGGGACCTGGCCGATCGGTTGTTATCAGCATTCGACAGCCCTACGGGCGTTCCGTGGTCGAGCGTCAAC
ATTGGCAAGTCCGAGGCCATTGCAGCACACGACAACGGAGGGGCGGCGTCTACAGCGGAAACGACGACACTGCAGCTGGA
GTTCAAGTACCTGGCCAAGCTGACCGGGGAGAAGGTATTCTGGGACAAGGTGGAGAACGTTATGGCGATTGTGGACCAGA
AGAGCCGGCAGTTCGACTCGCTGGTGCCAATCTACATTGACCCGTTAACGGGATCGTTCAAGGGACACAACATCCGGTTG
GGCAGCCGTGGTGACTCGTATTACGAGTACCTTATAAAGCAATACCTGCAGACAAACATGAAGGAGACCGTATATCTGGA
CATGTGGACAGACGCGCTGGCGGCAGTGAGAAAGCACCTGGTGACGTACACGGAGACATCACACTACACCATCATCGGCG
AGCGGGCAGACGGGCTGGAGGAGCCGCTGACGGCCAAGATGGATCATCTGGTGTGCTTCATGCCGGGAACGATTGCGCTG
GCGGCAACGCGCGGAATGCCGCTGCGGGAAGCGCGCAAGAGCAGCTGGTGGACAAGGCAGCACGACAAGGACATGAAGCT
GGCACACGAGCTGACGCAGACGTGCTGGGGTATGTACAAGTACATGGCGACAGGGCTGGCAGCCGAGATCACACACTTCG
AGATAGCGAATCCACCGCCGCCAGAGTCGTGGCAACACCAGGCACCACCCTCAGACTTCAGCCCGGATCCGGATGCACCG
TGGCGGAAAGACTTTATCGTCAAGTCGCCGGATTCGCACAACCTGCAGCGGCCAGAGACGGTGGAGAGTCTGTTCTATAT
GTGGCGGATAACGGGTGACATCCGGTACCGCGAGTGGGGATGGGAGATGTTCAAGTCCTTCATGGCGTATACGGCGGTCA
AGGACGGAGGCGGGTTCACGAGCCTGTCGAATGCCAACAAACTGCCGCCCGTCAGCAGGGACAACATGGAAAGCTTCTGG
CTGGTAAGTGGTCGAGGTGGGGGTGTTTATGAAATGAAGATGGCCGGAGACTGTACTAACACGTGGCTTCTAGGCGGAAA
CGTTGAAATACTTTTACCTGCTGTTCTCGCCTGACGATCTGCTGCCACTGGACAAGATCGTGATCAACACCGAGGCACAC
CCATTTCCACGTTTCGACATGGGGCCGCTGTTCTCCACCGGATGGACAAGGCAGCCAGCAGCGGCCAGCGCAGGGGCACC
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62