GenePrediction:GLEAN_23 Details

Name: GLEAN_23
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:179160..180043 (+ strand)
Length: 884
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:179160..179217 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_179:179247..180043 (+ strand)
Length: 797
>GLEAN_23 class=GenePrediction position=GCSC_179:179160..180043 (+ strand)
ATGGCGCGGGAAGAGGACTGGCTTGTCAGCAGGGCAGGGGGCAAGGGAAAGACATCAGGTAGCAAGACGGCGGCCCACGT
ACCAAAGGTGACATAGCCGATCTCGCCGGTGTCGGTGGTGCTCACGCCCGGCACGCCCTGCAGCTCCAGGGGGGGGTCGT
TGCGGAAGAGCACCTGAGGGGCGTTCTGGATGGCGCGCCTCCGGGCATCGACAAACTCCTGGATAAAGACCTTTCCGTAG
ACGCGGTCGGTCTCCTCGCGGAAGACGGTGCTGAAGATAACGGTGACGCGGTCGTGGCTCGCCTTGACGTAGATGGCCTC
CTCCTCGCGGTAGTGGACGGCCATGACCTCACCACCCTCGCGGATGCCCTGCGGCGCCTCTTCGGACGTGTACTTGGACG
CCTCTTCCTTGAGCTTGTAGTACTCGGCGAAGGCGGCCTCGAACGGGGCGGCCATCATGTTGCGCTTGAGCAGGGCGATC
TTGTCGACCAGGGCCGTGCGGGCCTCCGGCTCGGCCGGAAGCTGGTCGAGGTCGACAACGATGGAAAACTGGAAGCCGGG
CTCGGGCTCCACAATGTGCGGGCCGTACTCGCGCTCCAGCACCTCCTTGGCGCCATACTTGACCAGGTCGTCATAGCATC
GCAGGAGAATGGAGATTTGAATTTTCGACTTGGACTCGGGCGTGGAGATGTGGAACAGCACACCGTCAAAGTCGGACACG
GTCTGGTCAATGTGTGCAGGCGGTGCCCTGAGAGGATGGACGGCAGGAGACGTCAGCAGCTTGTCGGTAGGGAGAAGGGA
GGAGAAGGAGACGGATGGATCGGGGGAGAGCCCTACCCAGAGAATCTCTCTGTCAGCACCGTCTGGATGAGAACGTTCTG
GTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62