GenePrediction:GLEAN_240 Details

Name: GLEAN_240
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:481458..483319 (+ strand)
Length: 1862
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:481458..482811 (+ strand)
Length: 1354
Type: CDS
Source: GLEAN
Position: GCSC_167:482865..483319 (+ strand)
Length: 455
>GLEAN_240 class=GenePrediction position=GCSC_167:481458..483319 (+ strand)
ATGTCGGACAACGGCCATTCTGCCACGGATATCATCACATATATCGGTGTCCCGTTAGCCGTGCTGGGAGTGCTGCCGAT
CCTGTACAACACATTGACAACACTGGTGAACACGTCCAAGATCAAGCGGACGCTGCGGCACAGCCGACTCAAAGCACTGA
CGCGCAGCGATGTGGTCAACCGCGTGATCGAGATCGAGCTGCCGCGCTATGCGGTGACGCCATGGGACCGGTTTCAGCAC
CGCCAAGAGTACTGGTCGCTGTCACGCAACCCGAGCGCGATCCCGGGCGGCTCGTGGACGACGTTCAACTGGAAGACGCA
CGCGATCGGCGTCAAGACGCAACGTGTCGAGTACGCCGACCAGCTGCGCCAGCCACAGGTCGACGTCGCCCTGGACGAGC
TCGTGTGCTATCTGCTGGACCTGGGTGCCGTGCCCGACCCTCACGGCTGGCACCTACTGCGATCAACAGGGCTGTGGACG
CCCGTCGGCTGCGCGCTGATGAAGTCCCCCGACGGCCACCACAACGTGCTGACCGTGGCGCCACTCGACGACTCCGACGG
CAACCTGTCGCTGTCGGTCCGGTGGCGTCCGGAATGGACGACACGCACCTACGAGAACCTGCCGCCCTACTGGGTGGACC
TGCCGGCGCCGCCAGAGGCGAAGGAGAAAGCCGGGAAGGAAGAGACCGAAACCGGCACCGAGACCGGCACCGAGACCGGC
ACCGAGACCGGGACGCTCATCGACACGGCCGGACCTGACGACTCCAAGCAGGTGCCGTATGTCGTCCAGAGAACGAAGAC
GAGCAGCAGTAGTATCCCGCGCAGCTCGGTAGAATCGACGTCGCGGCGAGCGGCAACGCAAGAGACGTCCGCACAGAATG
CAGCTATCACGTGCCAGATTTCCATTGGCGGCATCGTGACGGCATTGGTGCACTCGGCATGGCCAGCCGGGGCAGCCACG
TCGGTCGAGCTGGATAGCCTGCACATTGAGCACCTGCGGGTGCGGCCAGGGCGACTGGACGGCGTATGGTTTGCCAGCGC
GGCCACGGCCTACGGTACGACGAGTCAGACAGTGCTGTGGAACTACCGGATCCCCGACGACATCCTGGCATTTGCACAGC
GCGAGACGGTACCATGTGGCGTGCTTGTGCTGCTGGGCATCGTCGACGAGAGCGCAACGCCTGAATGGGCTACCAAGCAC
ACGCAGGATCTCTCGGTGCAGATGGACCTGCACATGCGACGGCTAAATGAGCAGCGCGCCGCCCAAATGGCCGAGGCCCG
GCTGCCAGCACACCAGCGCGATCAGGCCTTTCGAGAGCGCACGATACAGGAGAACATGCAGCGGATACAAGACAGTGAGT
CAGAACAGGGTTGGTTCCTGGTGCTTTGCCTTACTGACACGCCTCAGTGCGCGACAGGAGCCGGCGCGATAACGACCGAC
GGCAACAGCGCGAGATGGAAGCGCTACAGAGCCCAAAGTGGGATGCTCGTCTGGTCGCTGGATACTGTCTGAGCTGGCTG
CAGAAGCAGAAGCCGAAACCGAAACCAGGCCAAAATCGAGAAAGTCACGTGACGGTCACGGAAGACCTCAAGCAGAGCGC
CGGCATGCTGCTGCACCACATGGTCCTGGACCCAGCCTTTGCCGGCGACCTGTGCCGCATGCTGGACCGCTGGAAGGCAT
GGGCCGACATTGGCGGCATGAAGGCAGCCGACCTGGCGGACCTGCGCCAGGACCAGGTGGCGTTTGCCCAGGCCACGCTG
CTGGTCGCCCTGATCCACGACTCGTCCAGCACCCTGGATGGCACGCTGTCGGTCGACCTGCAGGAGTGCCTGCGCATCTG
GCGTAAGGCGCGGCTGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62