GenePrediction:GLEAN_2410 Details

Name: GLEAN_2410
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:954636..957549 (+ strand)
Length: 2914
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:954636..955113 (+ strand)
Length: 478
Type: CDS
Source: GLEAN
Position: GCSC_140:955564..956232 (+ strand)
Length: 669
Type: CDS
Source: GLEAN
Position: GCSC_140:956306..956573 (+ strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_140:956625..957549 (+ strand)
Length: 925
>GLEAN_2410 class=GenePrediction position=GCSC_140:954636..957549 (+ strand)
ATGGACGAGATGGATTATGACATGCACATTCCGCCCGGCGCCCAGCCACCGTCCTCTATGGCAGAGGCCCGCCCAATTCC
GCGATGCCCTTATCTCTTGCCGAACCCGAGCCAGACTATGACGAACAGCAATCTATACGACCCGCTGCAGTTCTCGCCCG
GCCGCCAGCCGTGGTCCGGCTTCCGCCAGCCGCTGCAAAATCCATACGGGAACTCTTCTCGCTACAACCCTACCCCCTTC
TACATGATGCCGCAGCCACAGGAACAAGCGGACCGACCGCAGCCAGATGAGTTTCACCGCCAATCGCAAAGCCGAGCTAT
GACCTTTGGCCTGCAACCACCCTCTCTCACTCCGGCACGACCTGCGATTCCGGATATCTCACCTACCCGATCTAGCGGAC
TTCCGGGGGACGCCGGCAGCGGGCGGAATGCGGGAGAGTCTGCCGACAACCAGATCGATTGGGAAAGGCGTTTAGGAGGT
TTTGGCGAACGGCAGCAGCAGCAGCAGCAACAGCAACAACAACAACAGCAGCAATACCGGCATCAGCTGGTACCTCCCCC
CTCTACAGGCATTTGGACTTTCAGTTCCAACAACTCGACAACCAGCACGTACGGGGGAAACGCCGTCGGCATGAGAGCCG
GACAGGAACAGCACGCACCAGAGCAGGGACATAGGTATCAGACACAAGGGCAACAAGTGCAGCGAGAACAAATAGAGCAG
CAGCAGCAGCAGCAGCGACAGCAGCGACAGCAGCGACAGCAGCGACAGCAGCGACAGCAGCAGGATGAGGGACAGCAGGA
GTACCGGGAGGAGCAACAACGCCAGGAACAAGAACACCGGCAAGACCAGCGGCTACGGGCAGGTTCTGCTCCGTTCCAAC
CGGGCATTCAACTACCACGAGTCTCGTCTATTCTGAACGCCCCGCTAGCCCAGGATGTACAGTCGCTGCTACAGACTGAG
TTCCAAAGTAGTCCTTCGCCGTCCCATAGGTCGTCGTCTCCCGGATCTTCCGTTTCCGACAGGAGCCAAGCATCCGACCA
GACACGATCTCCAGGGCGGTCGGCAGCAACCGCACAATTTGCATCTGCAGCTAATTTGGACGACCCTCCTGTTCTGTCCC
ATACCACCCTTGACCGGGCCTTTTGGGACACGTCTAGTCAGCGGGCGGGGCGCGATAATAGTAGAAACTCTGCGACCGGC
CGACTGGAGTCGGCCCAATCGACGTCCCCATCCGGGTCGACTGTTGCTGTGCCGACGGCATCGGCAGCGTCCCTCCTCGA
GCGGAGGAGCAGAACCCCCCCGAGACATCGGAGGGCCGGACACGGTAGCAGCGGTGGAAACGCACGAGCGTCTGACTTGG
ATAGTGACGACGATATGGACTCGATCAGTGACGAGCAGCAGGCGCTCCACCATTTCATTGATCACCTGGATGGAAACATG
GCGGCGACGGCTCCTCCAAACAGCGTCTTTCCCGGAAGCGGGATTCGGGCGCGGCAAGTGCTTCGTGGTGCGGTGGCCAA
CAAGCGCATCGCCTCAAAGAGCGCGATTGCTTCGCTTGTCTGTGTCGAAATCGAGTCGCTCTCATCGACAGAAAGGAGTA
AGCAAGACACGTATGCACATAACTCCATGTAATCGCCAAGACCGCTAACAAATCCCTTCTCCCCGTCTAGCCTGCATCAT
ATGCTACAATGACTTTGGGGTTCCCAGCCCGGAAGGGATCAACGAGGCGCCCCTGCAGCTGCCGAAATGCAAGCACGTGT
TTGGTGATCACTGCATCAAGAAGTGGTTTGAGGAGTCGGACAGCTGTCCATATTGCCGTGACAAGGTACCGTCAGAGCCG
GTGATGCAATACACCCAGAGCGCATTGCAGCAGTTTATGAGAGTCCAGCACCTGCAGGCGAGCCGCCGTGGTGTTTCGAT
GCCTATGAACCCTCAAAGGTAGGACATCTTCATTCCAAGCGTTGTCTAGTTCTCTACTAACCCAGGCAGCATCATCGCCA
GCAGCCAAGCATATGCAAGAATGCTGCATGACCGCGAGGCGGCTATGCAGGACCTGATATCGCCAGGCCCTGGCAGTAGC
GGGCAGGGACGGCCGTTTGGGCTTGGCGACCGAAGAGCACCACCGGAGGAGTTTAATGAAGGTCAACGGCGGACACGTGC
TCGTCACGGGACCTTTCGCACATCCACGGCCAGACCGTTTGGCATGTCGGACAGCCCACAGTCGACAGCCGCAGCTGGAC
CGGCCACTGGCCAAACATCATCTCGGCCTGCACCGACACAGCACCAGGCCACGCCGCCGATACCGCCGATGCCAACAATG
CTTCGGCCACCTCCGCAGCCATTGCCGCAGCAGCCGATACAGTCGATGCAGATTCCACACCCGTTACCGGCACCGACACA
GCAGGCCCGTGAACGCTGCCTCCTGCCGTACCAAGCACACCTCAACTACACGTGGCAGCCCCAGGGCTACTCTCACTTTG
GGCCTCCTTCCCAAGGTACTTTCCACATGCCTCAAGTACCGCACTACATGCAAAATTATGCAACGGGGAACGGGTCTGGA
CCCGTTCCGGGAGTGGGGAATCGCATGAGTTTTCCCTCGTATCCGGCATCGATGTATGGGCCTGGGAGTGGCGAGGCCAA
CACATCCTTTGGGCACTCACAGGCACCAACGCTACCTCCGCCACCAGGCGCGGGTGAGGGGCGACCACATCTTCTCTCGG
CGATTCCGCCGCCGCCGATGCCGTCCCTTGAACCGCCACACAACCTCCCACTGAGCCCGGTGTCTTTGCCGCAGCACCAG
TCGCTGCCGCCGATATCCAGGCTGGATATGCCGAACCGGCTTTCGGGCCCGGCACCGTTATCGAACTTGCAAGATAGCAG
TTTTCCGAACAGCACTGCCGGTTGGGGGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62