GenePrediction:GLEAN_2414 Details

Name: GLEAN_2414
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:990069..991763 (+ strand)
Length: 1695
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:990069..990132 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_140:990210..990438 (+ strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_140:990503..991016 (+ strand)
Length: 514
Type: CDS
Source: GLEAN
Position: GCSC_140:991212..991763 (+ strand)
Length: 552
>GLEAN_2414 class=GenePrediction position=GCSC_140:990069..991763 (+ strand)
ATGGCCCGAATTGTTGTTGCTCACGCATTTGATGTGGAGCCCCCCAAAGACCAACAACATCCGGGTAAGACTTCATGTAG
CACGATTATCGACCGGTCTTTTTTCAGTCGCTAACATTGGGTTCGGGTACTCTGGATGCAGTAAAATGGTATCGCTCAAC
ATTCTATAACCTTACCATTCTCGGCCTCTGCAACTTTATGGCCCCCGGCATCTGGGGTGCCATGAACTCATTGGGTGCCG
GTGGCGCAGAGTCACCGGCGCTGGTCAACACGGCCAATGCCCTGACCTTCTGTCTCATGGTACTTTCGTGCTACTACTCT
GGTGCCATTGTGCACTACATTGGCATCAAGTATGCGCTCGTCATCGGAACGTGAGTCGTCTGTAGCCCCCACTGTAGCTA
TGATTGCTTGCGCTTTTTCTGATCGTCTTCACAGCATCGGTTACGCACCCTTCGCCGCTGGCCTGTATACCAACAACCGC
TTCGACAACAAATGGCTGGTGCTTCTGGGAGCTGCACTCTGTGGCCTCTCTGCTGGCATATTCTGGATGGCCGAGGCCGC
TATCGCCATCTCGTACCCTGAGCCGTGGAACAAGGGCAAGGCCCTGGGCTACTGGCTAACATACCGCCTCTGCGGACAGA
TTCTCGGCGGTGCCATCAATCTAGGAATCAACGCCAATAACGACAAGGCTGGCAAGGTGTCGTACCATGTATACGAGGTT
TTCATTGCGCTGCAAGCTGCCGGCCCGTTTGTGGCCTTCTTCCTCAACAAGCCAGAGCAGGTGCAGCGACGCGATGGCCG
GAAGGTCAACCTAGACATGACTGAAAGCCCATGGAAACAAGTCAAGCGGACAACAAGGCTCTTCTTCAGCAAAAAGTTCC
TGCTCGTCGTCTTTTGGATTGGCCAGGCCGCGATTTTTCAGAGGCCGTCTATTTTACATACATTGACGGTGAGTCGCAGC
ACCCATTTTGCTTTGATGCTGACAGTATACTGATAACACTGTTTTAGAATGGTTCACGGTGCGCTCACGATCGCTCGGAT
CCTTCTTGGCTGGCATTGTCGCGGTTATTTCAGGAAACCTGGTCGGGGTAAGACACTCTGGTGGGGTACTGACTTAAACC
TCACTAGCTAACGTATCGTGTAGCACTTCCTCGACCGCAGCAGTATCTCACTGCGGCTGCGCACTCGCTGGGCGTTCTGG
ACCATCGTCGTGCTGCAGGGCGCCTGGTGGACCTGGATTACCGTCATGGTTGCGCGCTACCGACACGAGAAGCCGACGTT
AGACTGGAATGACGGCGGGTTCGGTGCCGGATTCGGCGTCTACGTGATGCTGACGATCGGCTTTCAGGTCAACTATCTAT
TCTTGTACTTTATCGTCACCAACCTGGCTGTGTTCGAATACGATGTGGTGCACTTTGCGGCGCTTCTTCGAGGCACCGAG
TCTGCCTGGCAGGCCATCAGCTACGGTCTGACATCTCTGACCATCTTCGGCGAGGTTGGTGGCGTTTACTTCAACTTTGC
GCTCTGGGCTGTGGCCGTGCTACCGGCTTGGCTCGTCCTGCGCCACTTTGGCTCAGACCAGCTACACGAAGAAGTCTCAA
AAGAACCCGAAACTGACCATGAGGCTGTTCTAGAGGAAAGTGTTAAAGCAGAGAAGGAGAAGGTGGTTGACGTTGCTGCA
ACCAATGCAGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62