GenePrediction:GLEAN_2415 Details

Name: GLEAN_2415
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:993018..994883 (+ strand)
Length: 1866
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:993018..993141 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_140:993208..993671 (+ strand)
Length: 464
Type: CDS
Source: GLEAN
Position: GCSC_140:993753..993889 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_140:993945..994050 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_140:994119..994661 (+ strand)
Length: 543
Type: CDS
Source: GLEAN
Position: GCSC_140:994740..994883 (+ strand)
Length: 144
>GLEAN_2415 class=GenePrediction position=GCSC_140:993018..994883 (+ strand)
ATGGAAGAGGAGAAGAAGTGCAGCTCGCTGCTAAATGTAGCCAGCTCGGGTAAGGTCGAGGAGGGCGAGACCATCATGAT
ATTGAAAGACGAGCAGCATTTGGCCAATCTTGGCTACAAGCAAGGTTGGTACTACTTTAGGCAGCTCCAATTCCGGTGCA
GCTAAGCTAAAATGAACCGCCGCTTACCAGAATTCATGCGTCATCTCGGCCTCTTTGAGAACTGGGCCGCCACGTTTACG
TCCATGAACTTTGTCAGTGGCATCCCGGTCCTATTTGGTTGGGTCATGTACACAGGTGGACCAAAGTCTGCCTTTGCCAA
CTGGACCATGGTTGGTGGCCTGTCGTTTATCGTGTCGCTGGTCATGGCTGAGATTGCGGCCGCATTTCCCACCGCCGGCG
GCATATATTTTTGGTCATATCGGCTCGGTGGCGAGAAATGGGGGCCCTTTCTGAGCTGGATGACAGCCTGGTGGAACTGG
GCAGGCTGGATCTGCGTCGTTCCAGGTGTGCAGCAGGGCGCGACCAACTTTCTTCTCAGCGGTCTTCAGATCCAATATCC
TGATGCTGACGTGCTGACCAAGGGTTGGTTGGCCTGGCTTCTGACGGCTATTGGAATGGTTTTTGCCACTGTGCCCAATA
TTATCTCGCAGCGCGTTCTGCAGCTATAATTTCGTTTCGCCATCTTCATCTTCTTCGCCCTGTTTGCGTTGTATTGGACC
TGGTTTCCGGCCAAGGCCTCCGGCCACTTCCAGACCAGCACCGGGGCCTTTGACAACATTTACAATGGCATCAACGAGAG
GAATTCGAATCAAGCATCGGATTCGTATTGCTGGGTCATCGGCGTCTTGTTTGGTGCCTGGGTTTTTTACGGGTGAGAGG
AAGACAAGGGACGTGCAAGTAAGTTTAAATTACTAATCAACTATCAGATATGACGCCTCGGCGCACTTGGCAGAGGAGAC
GCACGATGCGTCCGAGGTGGTTGCCAAGGGCATGTGGATGTCCACCCTATCTTCCTGGCTCCTATCAATTCCGGTAAGAA
AGTGACCTCCGGACACAACAGCCTCCCACGTCAGCTCGATCAAGTTTCTTATCCATTGCAGACGCTCATTCTCATCCTGT
TCTGTATGCAAGACTTTCAAGGCATCATCTCGGCGTCTTACACCAACAACTGGGCGGAATACTTGGTGCAACTCATAGGA
AAGCCAGGAGCAGTAGCTGTCCTTTCTATTCTCTGGGTCGACTTGACCTGCGCTACCGCCAGCTGCTTCATGTCTGCTCA
GCGCGTGACTTTTGCCATCTCTCGCGACGGCGTCCTTCCGTTTTCGAAGTACTTTAGAAAACTCAACGAAAAGAAGATCC
TCGTCCATGCCGCATATCTCGTACTTGCCCTCAGTATCGCCATTACCTGTGCCGTCATCGGCTCGACTGTCGCCTTCTCT
GCTATCACAGCCACGGCCACAATTGCTACCAACTTCTCATATCTCATCCCTATCTGCGCCCGCTATACAGTCGGACGGCG
CAGTTTCCAGCCCGCCAAGTGGAGCCTGGGTAGGTACAGCATCGTTTTCGGCGTGATACCCATGCTCTATATCATGTTCT
TATTTGTCGTGCTTTTGCTGCCGCAGCTTTATCCTGTCACCAGTGTAAGTCACAGATTCAATCATGTGTACAATCCCCCG
AACAATTTACGCATGGTTGCTAACACAAGGACTGCACCATAGGAAACGCTGAACTATGCGCCAATCTGCATCGGGATTGT
CACCATCATCAGCCGTATTGGATGGATACTGCCCTTTGGCTTCGGCGGCATGCACTGGTTCACGGGCCCCAAGCGGACAA
TAGATGAACTTGAACACCGAGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62