GenePrediction:GLEAN_2416 Details

Name: GLEAN_2416
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:999924..1001706 (+ strand)
Length: 1783
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:999924..1000061 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_140:1000128..1001123 (+ strand)
Length: 996
Type: CDS
Source: GLEAN
Position: GCSC_140:1001181..1001381 (+ strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_140:1001443..1001706 (+ strand)
Length: 264
>GLEAN_2416 class=GenePrediction position=GCSC_140:999924..1001706 (+ strand)
ATGCCGAGTCTATCAAGTATTTCAGCGGCTTTCCTGGTGGCGTGCCAGGTCGTCCTGGCCGACGTGCCGACGTGGCCGAC
GCCAAGTATTGATGAGCTCGAAGACATCCGGTTTCTCATGAACGGATATAACGCCAGGGTGAGATGGACAAGCTCAGGCG
AGATGGAGCTGTCAGGGACTAAATGCTAATTGCGACTCAAATAGGGATTTAGCGACTTCGTCTCGCCATGCTCCTTTTCT
TCCGGTAACATCGGCAGAATTACGGCGGCAGAGTGGATTAGGGCGGCGTATCACGACATGTCTACGGCCGATGTTGCTGC
CGGCACAGGTGGCCTTGACGCTTCGATCCAGTATGAGACTGACCGAAGCGAGAACATTGGCACTGCGATGAACGACACGA
TGACAGCCTTCTTGGGATACTACACAGTCCGCTCCTCTATCGCAGACTTGCTTGCTCTGGGTGTCTACACCAGCGTTGTC
AGCTGTGGAGGGCCTAAGATCCCATTCCGTGTCGGGCGCATTGATGCCAAGGAGGCCGGTCCGTCTGGCGTTCCCGAGCC
GACGGACAACATCACAGTTCTTACGAACAAATTCGCCAAGCAGGGCTTCAACACGTCTGAGATGATTGCCCTCGTCGCTT
GCGGACACACAGTCGGCGGTGTTCACGGTGTCGACTTCCCAACCATTGTGCCCGGCAGCGGCACAGCTGGCAACAACTAC
TCGCACTTTGACAATACCACGCACTTTGACAACGACGTCGTTATCGACTACATGTCCGATAACACGAGCAACCCACTTGT
TGTCGGACCTGATGTTGGAAAGAACTCCGACTTGGCCGTCTTCAACGCCGATGGAAACAAGACCATGAACCGACTGACCG
ATGCTACCACCTTCCAGGACACCTGCCTCACGATGTTGGAGAGAATGATCAACACCGTTCCTAGCACGGTGAAGCTCACA
GACCCGTTGACGCCGTACCCCATCAAGCCAGCCAACCTGGTGCTCAAGCTCTCGGACAACGGCGCCAACCTGACATTCTC
TGGGCAAATCCGTGTCTTGGTGACAAACCGAGATTCAACAAAAATTGAATCTCTTTCCCTGCATTATCTCGCCAGAGATG
GGGTGACCCCGGGCGTGATTAACGCTACCGCGGCATTGTACCAAAGCGGCTTCGCGGGAGCCTTTGGTGATTCCTTCCAG
GTATGGAAATTCGGCGCTTCATTCTTACCATGCCTTCAAAACTAACCTTTGCCACAGTTTTACGAATTCGAGACGGTTCT
AGACGCCAGCAGTTCTGTCTCCTCCTTTAATGTTTCCATCGCCCTCAAAGATGGCACCGTGGAGGAACACAACAACAACG
GCGGCGGCTTTCCTGTGCAAAGCAGCATTCTCCTCCAGTCGTCGAGGACTTGCTACATAGCCAACTCGACCGGGTCGTAC
TTCAAGCTTGTTGCTGCCGTAAGTTGCTTCTCGGTTGTTTCTTAGACAAGTTCGGTGGCTAACCCAAACCAACCGATAGG
TGCACGACTCGCGCAAAGCCCTACCTGCTACAGTTGTGACTTATGTGCAAAACCCGCGCATCGGCACTAAGATCCCTTCA
CTTGATGCGGTCAACACCTCGCTGGCTTTTGTCAACTCTACTGGAGCGTATGACTTCTTTAGCGCCACAGTCTCTCTCGG
CGTCGATCAGGTATACCTTGCATATTGTGACTTGGTCAGTGGCGAGGGAGATGCCGCAGAGTCTGATCTCTTCCACAACA
TGGGGAACATCAAGGCATGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62