GenePrediction:GLEAN_2417 Details

Name: GLEAN_2417
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1009655..1019372 (+ strand)
Length: 9718
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1009655..1015944 (+ strand)
Length: 6290
Type: CDS
Source: GLEAN
Position: GCSC_140:1016009..1017252 (+ strand)
Length: 1244
Type: CDS
Source: GLEAN
Position: GCSC_140:1017310..1019372 (+ strand)
Length: 2063
>GLEAN_2417 class=GenePrediction position=GCSC_140:1009655..1019372 (+ strand)
ATGTCGGCACTTTCGTCCGACTCTGTCAGATTTATCGTCCAACAGCTCTTCCTGCCACCCCAGCTCCCCCAGCAAAAAGA
TCAAAAGGCTGATCTCGACACTGCACTGTTGCGACTTGTGACTGAGGCTCTTGAACGCTTCCAGAAAAATGTCCCAGTCG
AGGAGCAGAAGGCTGTCTCACTCGCCGCGGCGTCAGTGTCTTTGCTTACCGCATCTCGGGATTCCAGCGGTTCGGTAAAC
GAAGAGTCTTTTTTGCAGGCTTTTGGTGATTTGAGCCAAGCGTCCGCAACACTGCCGGGACCAGTACTTCCGCTACACAT
CGAGGCCCAGAATGCTGGTCTCCTCATCACTAGATCTTCTGATGGAATACTGTTTGAGGCATTTGAGCTGGCGCCTACCA
ACAAAGCGGTCATGTCGACGTCTGGCCGACTCAACCGTTCCTTTCCTGGACCTACAGTGACAGTGGAGGCCAGCCATTTC
ACGAGTCAGGTACAGGATCTCTTGACTAAAACCTTGTCGCGAATGAGCGGCGAGGCGGCCCCAGGAATGACACCGATAAC
CGTCAAGGCCAAAAAGAGGCTCAACGAGATCCGTGATACAATGGACCCAGGACTGGTCACAGAACTGTTGTTTGGCTTCC
TCCAGCCGATGGCTTGCTCCAAAGACACGTCTGTTGTCAGGATCGTGAAACACACACGCGAAGAGGTGCTCTGGGATCGC
GCATTGTTGCCATGGCGCCGGTCGCCCCTCTGGCTCTTAGTGCGTGTTGTTGTGCAGCTGGTTTTTTCCCGTTTGCGGGG
GCCGAACAGTGGCCGCAACTTGTACAAACTGTTCATGGTCCGGCTCCTTGCAGAGGTCCTCGACAGGTGCCTACAGCTCG
GAAACGGCATTGAACCAGACACACTGCATTTCATGAGCGCCAAGATCACGCGCAGGCTATTAAAACTCGGCGTTTCAAGC
GACAGTCCTGGAATTGTCCACGTGATCGACGTTCTGGAAAGAACCAAAGATGCACTCGATGTACGGTGGGCAGCAGCCTC
ACGTCAGTGCAAGAAAGACGCTCATCTCTCGCCTCTTGCATCTGTTGCTTTCAGAGAGAGCAGATCGCTTTCGCTGCCTG
CTTTGGACAACTTTTTGTCCGACATCCTCCTGAAAGAGGCTTCCAACTCTGGCGCCAGGTTTCAGCCAGCTCATAGCCTC
CAAGCGTTTCCAGAATACAGCTTTCCCTCGGGCCCGCTGTCCGAGCCACCACAAAACCTGGTCTACAACCTTTGCGGACT
GGAGCAGTGGGTGGAGCACAATTTACAGGAGTGGATGAAAGTGAACATCAGCAATCGTGCCACATGTCCGCTTGTGTACG
AGCTGATGCAGCTTTATCACAACTCGGCTAGCCCCACGTATATTGAAGATCCAGAAGCCAGCTCGTCCATGCTGCTTACC
GTGCTCGAGCTTTGGGTTGCTTGCGACCGTTCTGCTGTCCAGCGGCTTCCGCTACTGGCGGAATACATCCCAGACATTCC
GCTTCAGAAGCTGCAGACGCTAGTTCTGCCATGCCTTCGAGACTTGGAACGCCTTCGGCGTATCGAGGAATACGTTAAGC
GAAGACAGCAGTCGGCATCGGACAGGTCTGTTTTAGCCGATTTTGGCACAGCTGGATCGTTTGCTGTGCGCTACTTCAAG
CACTCCATGAAACACCAGGAGCTTTTGCAACAAATTGAAGCTGCAGCTTTACGGGATCGGCAGCGGAAACTTGCAGAGCT
CGCTGAAATGAAGTCAAGGTACCAGAATCTCATGAAACTGCATTCCGAAATGGTTTGCACCACAGAGGAATTTTACGGGA
GGTACGGGTGGTACGACCACCACTCGAGAGATTGTGAGAAGTGCTACACGGAAGAAACTGCCAGAGGAATGTCCATTTCT
GTGCACGAGTGGCCGCTGCCAACACAATCCAACGAGAAGAAGGCAGTGGTCTTTGAGCTGGATGCTCCGGCAGAATTCTG
CGCCTGGCGCGATGCCACGGTTTATCTCCTTCTCGACGTGCTGGGATCAGACTACGCCGATGCCGACCCACCTAATACGC
AATACTCACTTCCGTCATATGCGGCACTGAAGCCATACTATCGGAGTCCGTCACGACGCTTGGAGCTGTCGTCCACGGCA
AAACCAAATGTTGTGGCCCATTACAGAACCGTGTCCATCTCCACAGCCACAAAAGACCAAGTGTGCCTGAACAATGGGCT
ACGCTTCCAAGCTTTCGACACAGGAAAGAATTGCTTCGTTGTCGACATTTTCCATTCCGATGTTGTCCTTGATATGTGTA
CGTACCAGCTTCCCCCGGACAGTTCCTCATTGCAACCGTTTCTGAGGCGGAGCTTTGCCGACGACGGACAAGCCGATGCG
AAGCCGAACATGGTGATTGCAAGTCAGTTCGAATGCCCGACTCACATGACGCTCGCCGAATACCGCAGCCTGGCCGGCCT
GACGGTGGGTTACCGGCTGCCATGGCAGAACCTGCTGGTGCAGCTGGCCAGTCCATCGGTTGACTTCAAAAAGATAGAGA
CCGGTCTGTTTGTCCTTCAGGCGATCTACCAGGCCGGGCCGCCCGAGGCATATGTTCGCCGTGCCAGCCACCACATTCTC
ATCGATGACATCTTCGCCGAAAAGTTGCTGGCCACGATCGGTCAGGCGGCAGCACGCATCCAAAAGAACTGGGACTCCCT
GCAGGCGCTCAGCACACTCATCGACACTACTGCTCGCGTGCTGCGGCTGACGCCGTCAATCCCTATTGCGGACAAGTGTC
TGGTCATGCTGGAGCAGTTGCGTGTCATAGCCATTGATTGGACCGACGATCTGGAGAATCGCTATAACGAGGCAAAAGAC
GAAGACCAGAGGCAGGCCTTCCTCTGTAAGATCGTACAAATCGCCACCATCTGTGTCTGCACATTCGATGTGGACGACAC
CCACCTGCAGGAAGTACTGTCTGTACCCGAAAAGGCGGCAATCCTGATTCGCTGCAACATGCTCGTCTACGACAACAGCA
CGCAGATTGGAACCAAAGCCCATGACCGGCTCATGCGTCGGCGATGTCAGCATCTCTGCTACCGCGCATATCCCATCCTG
CGGCAGCTCATCTTGAATGGCCTGGACGGCAAGCCTTTTCCCAGTCTAGACACAGTCATACAAGCTGCATGGCCTAACTA
TCATCGAGGAGATAGTGGCTGGCAAGCCCTACAAGGAGAATTTGACCAGTGGATCGTCACGGACATAAAAGACTTGGCCG
TTGTGCACTACAATCTGCTGAAGGGTCGCCTGCTTGTCAACGGCCGACCGTTGGACCGCCTCCCTCTCGAATATACGCAG
CATGAATCGTACGTAGCACTCTTCGGTCCTATCGTTTTCCGCATCCTGCCGAGCATAGTGCCAGGCATGCAGTTTTCGTC
CAGGGACAGCTATCTTGAGCATAAGTTGAATTTTGGTATGGGCAGCACCGACCCCGACATGCTTCTGCAGGCCAAAAAAA
ACGAACAAGTGTACCACCTTGTTCCAAAGAGGGTCTTTCAGGGGGTTCTTCCGACCTCGCTCGTCCGTGACTTCGTGCAC
TGGTACGATGCAGAGAATGAAACTGTGGAGTTTCGCAAAAGGCGGCATATGTGGTCGACCGAAACTAAGCCGTCTTCCTG
GCGCCTCAAACGAGTTCGCAAGGAATCCATTTTTTGGTGGTTGTCGAATAAACAGGGACAGTCGCTCGTGTGTCCGAGCA
GCGGAGCCGGGCGGTCGTTGAGTGCCGTCTTTGCACCTCTCCAGGAGCCGTTGGACATGCTACTCATCCTACGGTCTGAC
AAGACAACACTCGACATTGAGCTGCCCCGGCTGCAGCTCAGCTTCCACTTGGCAGAAGGAACATCGGTGGTCAACTCTCG
TCAATGTCGGGGATTTCAGGTGGACAAAGACCAGAATGTGGGAACGTTAGTTGGTTTGAAGAGCAAGCTGGTGTTGCAGA
ACCGGATCACGGCCGAGAGACGAGTGATAGTGCCGACGGGCTGTATCTCGTACGAACGAAAAGGTGATCATACAACCGTG
TCCATATTCCCGGAAACGGCCCCGGCCTACATTTTCAAGCGCAACGACGACATGCAGCGGCTGGACGGAAGCGGAAGCCT
GCAGAGCTCTCTCCTCCTCTGCTATCTGCACGCACTGACGTCGTTTTGTTTGCCCGACGTCTTCACCGGATGCACCGGCA
CAGAGCAGGCGCTGAACATTCTCCGAAGCGCCGCCGTCGCCTCTAACCAGTTCCTAACCAAGGCTGACGTTGACTTGCTG
CGGAGAATTTCGGGATTGACTCCCAAGCGAGTTTTCTACCCAGATCATCTGCAGGTCATGCAGACGGTCTCGTGGGATCC
TCACCTCCCGATGCTGGCACAGCATCCGCACTTTTTCCAGGCCGTCCAGACGTTGCTCAAGGAGAACAAAACGGCCGAGA
TATACTACCCAGATAGTGACAAGCAGCCGGCCAGATTTGAGTCCGGCGATGTCCAGCTCTGGACGCGAGATGCCTCCCGC
ACATCCACTGTGCGCATCACCGGCTATGGGGCCGAGGACCGGTTGTCTGCGTTGCACGACATTGAATATGTGTCTAGGGA
CCTTGGTCAGGCGTCTCAGAGAGCCGAAAGGGCTACAAAGATATCATCCATTATGTTCGAACGTACTCCTTACCTTCGCA
TTAGACCACTGGGCAGAGAAAGACTTTCGTCTCTTCTACTGAAAATTTTTAAAGAAAAGGGCACGGTCCTTGGAAGCGAT
TTCCCAACAGATGGAAAGACGAACAACTCCTGCCTACTGGACTATGCTGGTAAGTGGATGCTAAACCATGATGGACATTG
GGCCGAATTGTGGTGCTGGCTACATCGCCAGGCAAAGGGGCGGAAACTATGCCCATCACAGCTGAATCTATGGCTCGCGA
CAATGGCATTTTCCGCCAAGGACATGGAGGTCATCCAGGCAGCCGCGTGTCTGTTTCTACTGCCAGAGGTCACTGCCATC
AACCCGCCGCCTGTTGGAATGTTTCAGCTTCGCCATGGTGATACACCAGACAAGACAGAACTGACTCAGCTCCTCAGCAA
CGCCGAGCTCTGGAAACCACAGGATTCTTGTCCGGAGAACAACTTACCGAGATACTCCGGGGAGTCCAACAGGGACTATG
GTCGGCGGCGAGAGTGTGCATGGGAGTCGAGCAAGAACCAGGCCATTTCCAGCCTTGTCGACCACCTAGCGGCACAAAAG
GCCCAGCCAGTGCCTCTTCCTCCAACCGGGGTCACGAAGGAAAAGATATGCACGTACATAAAACTGCAAGACGCCATCAA
TGCCGTGAGGGTCAAGTTCACCCTCTGGCACCAAAACTGGTTGTTCAAGTGCTATCTGGATGAGATCGCAGACGCCATCA
GTCGGACATCAGTGCAGCTGTTGCAGCTCCCAAAGATCACGACCAGTCGGCCGCTACCCGCAAGCACCATACAAATGGCC
ACCATTCAGCTCGCGGATGTTCTCGAAAAAGCCACAGTTCCTGAAAGTAAAGAACTGCCGCATGCTGGCATACCGAAACT
GACTGTCAACGAAGCTCTACCGCTCTACAGTTTGCACCTTGGCTTTCAATCACTCACACTGCAACAGAAGCAGCCGCAAG
CGGAAGCAAAAAAGCCGCGCCTGGAAGCTCTCGTAAAAAGTCTGACCGCCAGCGCCGAGTCCACATACGAGAGGGAATAT
GCGGGCGAGCTCCGCCACAGTCTAGATAAGCTACAGGACCAGCATCAGACCCAGCATGCGAATCTGGATGTGGATGGCGT
GGATCACGTGACATCCCGCATTCGCCATCATCTTGACCAGGCAACGCGATATCTCGACGACCTATTTTCCACCATCCATG
CTGGTGTGTATGAGAACGTGAGATGGGACAAGTGCTTGGCCCTGCGACTCGGTCACAGCCCTCGGCTGTCTCGCACTCTC
CTTCTGCAACAGCTGGCCCGCGACGGTTGGGGCAAGCTGCAGGCCGCCTGGAAGCCATGGATTGTAGCCTATGGGCTGGC
CCTGACCGAGACACAGCGGGCACAGCGAATGATGCGCCTGGTACGGGATTCTGATCAGGTGAAGACCCATATTGGTGAGC
TCTTGCGCGAACTGCAGAACGAGGGCCACACCAACTGGGAAGCTTTCAAGCAGCCCGAAACCCTGTTGCTAGAGGTTGAG
AGCGGCATCCTGATCCGAGCAGTGCAAGAGGACATTACAGAGAAGATGCGGTGAGTGTGATTTTTTCCCTCTTGGTCCTT
TGTTACTGCTTGTTTCCCACGCTGACCTGTTAAGACAACCACCGCACGACCAAAACGCGGTGATGCAGCTGAACATGGGC
GAGGGCAAGTCGTCGGTGATCGTGCCGACCGTCGTGGCAGCTCTGGCCGACGGAGCGCGGCTAGTACGCGTCATTGTGGC
CAAGCCACAGTCCAGACAGATGCTGCACATGCTGGTGGCCAAGTTTGGCGGCCTGCTGAACCGTCGCGTCTTTCACCTGC
CCTTTTCGCGGGCTCTCCGACTGCAGGAAGAACATGCCAAGGCCATCTTCGCCCAGTGTCGTCGCTGCATGGAAACGGGC
GGTGTCCTGCTCGTCCAACCAGAGCATGTCCTGTCACTGCAGCTGATGGGCCTCGAAGCCATGGCCTCCGGTCGGGAGAC
GCTCGGCTGCTCCCTGCTCAAGACGCAACACCTTTTTAATACGGCCGGCCGCGATGTCGTCGACGAGAGCGACGAGAACT
TTAGCGTCCGATTCGAGCTAATATACACGATGGGCACGCAGACTCCGATTGAGTTCTGTCCCTACCGTTGGTCCGTCATC
CAGAACGTCCTCGAAGTCGTCCGGAACCATGTGAAAGACGTGTCCGATCAGCTGCCGCTGTCCATCGAAATTCAACCGAC
AACGACGACTGGACATGGAAGCTTCCCTCGCGTCCGTCTGCTCAAGTCTGATGCTGTCGAACTTCTCCTTCGCAACAAGG
TGCCCCGGGAAATCTGCAACACCGGTCTTCCTGGATTCCCCATTGCGCGGCAAGCTCCGGAATCACGTGACGCTGTTCTC
CGCTATATGACCGAGGCCGACCTGCAGCCAGCAGACATTGACGCTGTCGAAAGTGGCCACTTCTGGACGGCAGACACACG
CGACTGTCTGCTGCTTCTACGTGGCCTGTTTGCTGGAGGCCTGCTCGCCTTTTCCTTTGGCCAAAAACGCTGGCGTGTCA
ACTATGGTCTCGATACCTCTCGACGACCACCGACGAAGCTTGCGGTACCATACCGAGCCAAGGACCAGCCTGCTGCACGC
TCCGAGTTCAGCCACCCCGACGTGGTCATCACGCTCACCTGTTTGTGCTATTACTACCAGGGTCTGGACGACGCCGACCT
GTATCTGACTTTTGCCCACCTGTTGGCCTCTGGAAATGCCGACGACGTGTATCAGATTTGGGTTCATGCCGCTAACAATC
TCCCGGACGCCTTCCGTCAAGTCATGGGCGTCAATATGGAGGACCGGATCCAGTGCGAGACCGAAGTGTTCCCCGCATGT
ACGTCTATTACGCTGCTCGTCATATGTCGTCCTGATCGCTAACCCTTGTCTACAGTCCGTTTTACGAAACCGACGATTGA
CTACTTTCTAGACAACATCGTTTTTGCCAAGCAGATGAAGCAGTTTCCGCATAAATTGTCGGCCTCCGGCTGGGATCTCG
GTGCGTCAAAGACTCAGCGAACTACTGGCTTCAGCGGCACCATCGATTCTCGCAAGGTCCTACCGCTTGACATGACGTAC
CTGGACCTACCGGAACAGAAGCACACGAACGCACTTGTCCTCGAGTATCTTCTGCAGCCAGAGAATGGTGTGCTGCCGCT
GCAGCCACCGCTACCACAAGACGCCGATGCTCCTACTTCGTCTGTAGCAGAAACCCTTCTGAAACTCGTCGTGGGCCAGT
CGAATGACCGGCTGCGTGTCATTCTCGACGTCGGTGCTCAGATCTTGGAGTTGTCTAACCGTCAGGTGGCCAGCCTCTGG
CTCAAGATGATGCGCGAGCGCCATGCCCACGTCGAGGCTGCTGTCGAGACTGCTGTCGAGGCTGCTGTCTATTTTGACGA
CAGGGAGGAGCTGATGGTCCTGGACAAACGGGGCCGAGCTGAGCCACTCCGCATCTCGCCGTATGCCGACCAGCTGGACC
TCTGTATCGTTTTTCTCGACGAGGCCCATACGCGCGGCACAGATCTGCGCCTGCCCTCGTCTTACCGCGCGGCCGTCACA
CTCGGTGCCCGTCTGACTAAGGACAGGCTGGTCCAGGCCTGCATGCGTATGCGGAAGCTCGGCCACGGCCAGTCTGTCGT
ATTCGTGGTGCCTCAGGATGTTCAGACTCAGATCCAGGAGTGCCGCACTCACGAGGAACAGCAGCGGGACATCAGCGTGC
TAGAAGTTCTGAGCTGGGCCATTGGCGAGACTCATAATGATCTTCGCAAAAGCATGCCGTTATGGGCTGTCCAAGGTCGT
CGATTTGAGAAGCAGCTGGCCCTTTGGGAGAAAGCACGGGCTGCAGGTGAAGAAGACGACATGATCGTCATGACGCACGA
CCTGGCTAGCGAATTTCTCGAGGACGAGGCCAAGACGCTGGAAGAACGCTATCGCCCAATGCCAGAAGGACAGACTGACA
GCACAACCAACATGCGTGGCGACAGAACCAATATGCGGTTGCGCCAGATCGACGACCGCTGTGCCGAGGTGTCTAGACTC
AATTTCTCTGAGACGACCCTGCACGAGGAGCAGGAGCGGGAGCTGTCCCCCGAGATCGAAGAGCAGCGCCAGATAGAGCG
GCCGCCTCCAGCCACGCCAGCCACTCATTCTGTGCATCAAGACATCCGCACATTTGCTGCCACTGGACGGCTGGCTGCCT
CCTCGTCCGCCGTCTTGCCTGCATTCCAGGTCCTTCGGGCTACCAATGCATCTGCCCTCCTCGATGTAGACATGTTCCCG
CAGGATGTGCTCGTCACAGCCGACTTTGCCAGTACGATCGTCCCTGAGCATTTCGCCAACAAGGACCAGCAACTGGACTC
CTTCCAGCGCCCTCCCCAGTGGATCCTGAGCAGTCAGCCGGTCAGCTGGGATCGGGTGGTGATCATTAGCCCATACGAGG
CACAGGAGCTGCTGCCGACAGTCCGCAAGAGCCACAATACATCTTTGCATCTATACGCACCCCGTCCCAACCTGGAGGTG
TCGCCGCTGGATGGCCTCGATCTTTACACCACGTCTGCTGCACGACCGCCATCGCCTGAGCGTCTACCGCTCCCACTGGC
ACTGCTACTCAACTTGTTCTCTGGTCAGCTGTACTTTAAGTCCTTTGCCGAGTACACAGCAATGTGCGACATGCTCCGGC
TTTCGTGGCAGGAGGCCAGCGACACGCTTACCATCGAGCCGGATGGCTACATCCACCATGCCGATAATGCAGACGACATC
CCAGGTTCAGAATTTACCCAGAGCCCAGTCCCGTTTCTCAAGGCGTACTGCTCAAAAATTCGCCGGGACGGTCATTCGAT
TGACCGCACGCATCTTGGCAAAATGCTAAGCGGGGTTCTCCTACGAGAGCTAGAACTGGACGGAGAATCGGTGAAGGGAG
CTTATAGAGCTCCGAATCTTGGAGCCACCAGCATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62