GenePrediction:GLEAN_2419 Details

Name: GLEAN_2419
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1024181..1027514 (+ strand)
Length: 3334
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1024181..1025611 (+ strand)
Length: 1431
Type: CDS
Source: GLEAN
Position: GCSC_140:1025681..1025871 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_140:1026446..1027302 (+ strand)
Length: 857
Type: CDS
Source: GLEAN
Position: GCSC_140:1027381..1027514 (+ strand)
Length: 134
>GLEAN_2419 class=GenePrediction position=GCSC_140:1024181..1027514 (+ strand)
ATGGTGTCCGAGATAGCAAGCCGGACCTGGGATGACCCCCAATGGCCACCCGGCACGGTGCGGCTGGAGCTGATCAAGGC
CGACCACAGCACCGAGATCGTGCTGCAGCCACGGCCGACGTCCGACCCCAACGATCCGCTAAACTGGCCGATGTGGCGCA
AATACCTCAATTTTGGCCTCGCCGCCTTCTTCGCCCTCATGGTAGCGGCCCAGGTGTCGGCCACGACGCCGACCTGGGGA
CCGATGGGCGACGAGCTGCACTTTAGCGACGCAGTGCTCAACGACACCTATGCCATCGGCTGTGCCACGCTGGCGCTCGG
CGGCTTCATGCTGATTCCGTTTGCGCTCAAGTACGGCCTGCGGCCAATCTACGTGCTGACCTGTCTGGCCCAGCTGGGCG
TGATGATCTGGGCTGCCCGCACCGAGACGGCCGGCGACTGGTGGGGCGTCAACGCGGTGCAATGCTGGCTTGGATCGCTG
GGTGAGTGCATGGTGCAGATGACCATCACAGACATCTTTTTTGTACACCAGCGCGGCCTGATGAACTCCATCTACGTGTG
GGCCTACAGCTTCGGCGGCAACCTGGCGCCGGTGGCGGCCGGATACATCACCTACTCGCAGGGCTGGCGTTGGGTCTGGT
GGTGGTGTGCCATCTTCTTCGCCGTCGAGACGGTCATCATGGTCCTAGGCTTCGAGGAGTCCAAGTTCGACTGGACCGCC
GTTCCCATCTCGGGCCGACCGCTGGACGTCGAACAGATCGTCGACGACAAGACCGACGAGAAGGGAAGGCCATCGATAGG
CGTGCGAATCCCCGATCTCGAGACCGACTCGCCTGATGCTGTGCCCTCCGAGTCAGATGCCTTTGCCAATGGCACTACCG
TCGAGATCAACCAATCCATCCCGCGCAAACCGTACTGGAAGCGCCTCGTCTTCACCACCACCACTAAGGGTCCCTGGCAG
CTGTTCGCCCGCCACGCCTACCAGCCCTTCATGATCATGTTCACCATCCCCGGTATCGGCTATATCTGCCTCGTTTATGC
CGTCCTCCTCTCCTGGGGCACTGTCATGTCCGCTGCCCAAAGCACGTACATGATTGAGCCGCCCTACAACTTCGACTCCA
CTCAGATCGGCCTGATGAATCTGCCGCCGTTCATCGGAAACACCATCGGCACGCTGATAAGCGGCCCCCTCAGCGACTGG
ATCGTGCTCAAGCTGGCCAAGCGCAATGGTGGCATCTACGAGCCCGAAATGCGCCTGTGGATTATCCTGCCATTTATTCC
CCTCCAGATCGCCGGGCCGTTCTGGTTCGGCTATGCCCTCCAGGACGGACAGTCCTGGGTCTCTGTCGCCTTCGCCACAG
GCCTCACAAACTTTGCCCAGGCACCCATCACTAGCGTTTTGCTGACTTACATGCTCGATGCATACAACGAGGTAAGCAAG
CCAGCTGTCTTCGAAACCGGAGGTAGATAGGACTATTCAGCTAACTTTCCTCCCTCCCAGATCATCGGCGACTCTCTTGT
CGCTCTCACCTTCTCGAGAAACACGTTCAGCACCGTGTACGTCTTTGCCATGACGCCATGGATAGCGGCCGTTGGCATGT
CCAACGTCTTCAACACGATTGGGGCCATCGGTGTCGTCGTTCTCCTCTTTGCCGGTGTGTTCATTTGGAAGGGGAAGCAC
TGGCGCTACCGGTATGCAAAGCAGTACCAGTATTATTCATTGCGGCAGTTCGATCCGCGGCCGATCAAGAATTGAGATTT
AGGGTCAGGTGTTTGAATGACATCTGTGCCACAGAAAGAGAAGTGGTCATGAAAAGGTCTACCCCAAGAGACATATGCAT
TATGACAAAATACACGTACCATTACGCAGTCCTCTGAGTCGACAGGTTTATACTGAAAGCCCAACTGACAGCGACGATCG
TAGTGGGGTAGAATGGGCGGTGACGAATGGCAGAAACATTGGAAAGGCCCTGTTGAAAGGGAAAACAGAGCTCACTACTC
CGTAATAATGCTAGGACGTTCTAAAATCGATCAATAGGCCTCTATCCCAGTCTTACCACCTAACGTATCACCAGAGAGAC
AATGTTTACGCACGAATCGGAAGTCTGAAGACAAGCTTGCCTAATTATCGCCAAGGTTGCTCCAATTACCCCGCACAAGG
CTGGGCCGCTTCTTCTGCTGCCTGTTGAAAATGGCCACCAATCTGCCTTTACCAGAGCGCGACTTGCCAGCTTCGGCTCT
GATTGAATACCCGTATCGCTGGTAGCACGCTGGTCACGATGCCGAAAAACACCTACATCTTCGCGCCCAACCACTCTACC
ACGCCTGGTGGAGTCATCTGTCTTGGCCATGTCCTGGGCGATATCTCCAAGTTTGTGCCGATTAACCGCAACGACGTTGT
GCCCATTGAGAACCCCAACTCGATCGGCCGAAAGCGTGGCTTTACTATGCGCCGGGCTCGGATGGCTAGCAGCAAACTGG
GTATATTTGGTCAGATCTTCAGTCAGTTGGGCGTCGGTGTCGACGTCGGGATCAGCGCTAGCCGCAAGCGCACAGACATC
CTTTCGGTCAACTGTCTTGACACCGAATCGTTCGATCCCACCGATGCCTACATTTCCGATACCATCAAGCTGCCCGAAAT
TGCCCTATTTCTCTCCGATACGCACTACAAGTACCCTCTGTACCTCATCACGGGGCTCAAGATTGCCCGCGATGGAGGCA
CCAGGCGAACAGCCAAGTACAAAAAAATCGATGCCGCTGGCAGTCCCGTGGGCAGCCCGCCTATGCTTCCCGCACCGGTC
GGGGAGAGCTTGGGCGACGCGTCAGGCTCCGTAGGCTCTGCCTATGCGAGCTCGACCGATTTTATTCTAGCACTACGGGT
GCTGAAGATCGCGTTCAGACATGGCCAGCTGCGGCATGCACCGTATATCAAAAAGGAGAAGACTACAATATTCAACAGCG
ACGACAGTGCTAGCGGCGATGGCAAAGGTGGCGAGGCTGCGAACTTTATGGTGACGGACGTCTCAATTGAAGACGTGGAT
GACGGAGAGGTACAGATTAAAGAGGTCGATTATGGTGATGATGACGTTTGGCTGATACCTGTGGCACAATACTGCGTGGA
GAGTGAGTAACGGTCTGTAGAACTTATTTGCATTGTGGCGAAATGACAGGTCGTTGGAAATCGTGATTGAGTACACGTAG
ATCACGTTGGAGCTATTTTCCGGGAAGAGCCGCTTCTTATGGCCACCGTCGTTGGAGGTGGCTGCGAAGAGGATCATACC
GGCGTCAGCGTCGCGGGCGATTCCAATGCTTCACACTCTGTCGCAGCAGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62