GenePrediction:GLEAN_241 Details

Name: GLEAN_241
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:485409..486559 (+ strand)
Length: 1151
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:485409..485429 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_167:485491..485625 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_167:485685..485710 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_167:485779..486559 (+ strand)
Length: 781
>GLEAN_241 class=GenePrediction position=GCSC_167:485409..486559 (+ strand)
ATGTCTGAGCGCAAAGTGCTGGTGCGTACAATCCAGTCCCCGGATGTACGACTCTGTCCTGCTAACTGCTAACCGTCTCT
AGACCAAATACTACCCGGCGGATTTTGACCCGAGCGTGCTTGAACGGCGCTCTCGCAAGCCGAAGAATGCTGGTCCGGCA
GTTCAGGTCGTGCGTCTGATGGCACCGATGAGCATGCGATGCACCCGTTGCGGCGAGGTAGGCATGTCCCGGGTGCGAGA
ACGACGAGGAACGCAGTGCTGACCGTACGAATTAAGTATATCTACAAAGGTCGCAAGTTTAAGTGCGTATGGCCCAACTT
TTCTTCTCTCACTCCATATAGTTGGACCTCCCCAGCTAACGCCTGACCAGCGCGCGCAAGGAGACGCCCGAGGATCTCAA
GTACCTCGGCGTGCAGATGTACCGATTCTACATCCGCTGCACGCGGTGCAGCGCCGAGATCATCTTCCGGTCGGACCCGA
AGAACCAGGACTACGCTGTGGTGTCGGGAGCGAAACGCAACGTCGAGCCGTGGCGCCAGGCGATCGAGGAGTCGGACGAG
CAGCGGCTAGACCGACTCGAGGCCGAGGAGGCCGAGGCCAACGGCGAGGCTGTCTCGGAGCAGAGCCGCATGGAGGAGCT
CGAGGCCAAGACGCTCGAGGCCAAGCGTGAGATGGACGTGGCCGACGCTCTCGACGAGATCCGCACGCGTAACGCTCGCA
TAGCCCGCGCCGACCACCGCGACCATCTCGAGGCCGTCGCGCTGGCCCGGCCGTCGGACGAGGAGGAGCGGCTACGCCAG
CAGGACCGCGAGGACGAAGAGGCTGCCCGGAAGGCGTTTGCAGCAGCTGCTGCTGCTACCACATGGCAGCCCGATGCGAT
TGAGATTGTGGACGACGATATGATGGACGACAACGTTGAGCGCAAGATCCGGCCGAACGACCCCTTGGCTCGGGTGCAGG
CCGCCATCCAAAGGCTCAACAACGAGGACAGTTTCGGCGAGAGCAGCTCTGGCGCGTCCTCGCCGTCGACCATAGCATCG
CCAAGGATGGATGCGGCTGCTTCGACCGTGCCCAGCTTCAAGCGGCAGGTCAAGAAGAAGAAAAACCACGCCGCGTTGCT
CGGCATTAAGAAGAAGCCGTCTCTGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62