GenePrediction:GLEAN_2422 Details

Name: GLEAN_2422
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1034081..1037639 (+ strand)
Length: 3559
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1034081..1036383 (+ strand)
Length: 2303
Type: CDS
Source: GLEAN
Position: GCSC_140:1036820..1037411 (+ strand)
Length: 592
Type: CDS
Source: GLEAN
Position: GCSC_140:1037505..1037639 (+ strand)
Length: 135
>GLEAN_2422 class=GenePrediction position=GCSC_140:1034081..1037639 (+ strand)
ATGCGGGCCGACGAGACTGCCGTCTTGCCAGGCTCCACGATGAGTGCATCCCCAGGTTTGAGCCAAAGCGCTGGGACCGG
CACTATGACCGGCAGCGCAGCGATGGGACAGGCAGAAGTGCAGCAGGTTCGACAGGTACAGATGCATGCAAGCTATCAGC
CTCAATCTCAGCCACAGCAGCTAGATTCGGTGGCTCAGGTCCAAGCTCTGGTCCAGGCCCAGGCTCAAGCTCAGGCAGAG
ACACAACCGCCGCGACGACGTGCGGGTGTGGCCTGCCGGCGCTGCCGCCGACAACGGACAAAGTGTCTGCATCAGCAAGG
TCAGGCGCCCTGCGACTCGTGTGCGGCCGCTGGAGCAGCTGTGGCGGCGACGTGCAGCTTTCCCACGCGTGGCGAGAAGG
ACACGGACCGACTATTCCGGCGGCGCAACAACGGCCAGCTGATCGGCCAGGACGGCCTCGTCAGCCGGCTATCGTCGAGC
CCTCCGGACCGCATGTCGACTGCATCGCCACGGCCACCGCCATCGCCACCGCAGTCGTCCTGCACGAGCACGACGTCAGC
AGCCATCATCACTACCGCCACGGCCAGCACGACCGCGCCCTCCTTCCCGCCACATGACGAGATCGTCGAGGGCTGCAAGG
TCTTCATGTCGTCGTACTTCCAGCTCGGCTTCCTGCCCAAGGCCGTCTTTCTCGAGCGACTGCACCGCCACCCCGAGACG
GCCAGCCGGTTCCTGCTGGCCAGTATGCTGACCATCTCGTCGCGCTTCACGCCGGTGCTGGTGCGGCGCTACGGCTCGCC
CGCGGCCACGACCGAGTTCTTCTTGGCGACCGCCCGTGACATGGCCGCCGCTCACGACAACATGTACCGGCCGTCGCTCG
AGCGGACGCAGGCGTTCTTCCTGCTGGCCATTGCCGAGTGGGGCAACGGCGACCGTGACCGCAGCTCCGTGCACATGGGC
GTGGCCGTGCGCATGGCCGCACTGCTCAAGCTGCACCGCGAAGAGGCCTACGTGCTGCCGCCGACCGCATCGTCAGACCA
GATCGTGCGCGCCGAGTCGGCCCGCCGCACCTTTTGGATGATCATGAGCCAGGAGAACCTGCACGCCGGCCACATGACGC
CGGCCCCGTTCGCGCGCGAGGACATCTCAGCCTGCCTTCCGTGCGACGAGGCCGACTTTGCCTTTGGCATCCTGCCGTCG
GCCGCTACCCACAACGAGCGCGCCGCTCTAGCTGGCACCTTGCCAGCTCTGCGTCGTCCCGAGCTGGCTTCGCTGCCGAA
CCGCTGCCTCTTTGCCACCCTGATCCAGGCCCACGATCTATGGGGCCGCGTGGCGCGCTGCACCGCCAGCGAGCCGTGTC
CGTGGGAGCCCGACAGCAGCTTCCGCGATCTCACCGAGGCCCTGCGCCTCTGGGAAGACGCCATCCCGGCTCGCCATCGC
TGGAGCGTCTGGAATTTGCGCGGCTGGTGCGCCGAGTCCCTGCACCTCGCCTACCTCTCCGTCGTCATGGTCGTCCGACT
CGGCAACATCGTCATTCGCCGCATCTACCTCGAGCGCATCATCAAGGCCCTCGATGCTGACGACGACGACAGCAACAGCG
ACAGGACCGCCTCTGCCTTCTGGCAGACCGTCTCTTACGACCTCTTTGCCAACGTGCTCGAGCTGCACGAGCAGGTCGAC
GCCTACGCCCGCATGCGCATGCGTGACGAGGGCTTTCCCGCCATCCTCGTCTTCTGCGCCTACATGTGCGGCTCCCTGAC
GTCCTACCTCGGCCGTCACCCCCGTCTCTGTCCGCACATCTCGCCTGCCGAGGCCCAGGACATGTCGCGTGGTGCTATCA
AGGTCCTCAGCGAGCTGCAGCCGGCCTGGCCGACAAGCGCCAAGTGGCACCAGGGCCTACAGCAGGCCTCTCATGCTGAC
GCTGCTGCTGCTGCCGCTGCTGCTGTCGTCTTGGAAGCCCCTCCACCTTCTCCTGCAGCCGCGGCCACACGAACGAACTA
CGCTGGCGAGACGTCTACGTGCATTGCCACGATGCACGACGAAGGCGCCGCCCTCGAGAGACACCCCTTTTCTGTCTCTG
TCGTGCAGGCACCTACGCCTCTGCCTCCGCGGCCATGGGATGGCAACACCCCACGCGAGCGCAACGGTGGCTTTGAGATT
GTGCCCGGCAGCTTCTCCTTGGCTGACAACGTCAACAGCTCCTACGCCATCTTCCCACCGCTCGACCCCTTCCTCGACGA
TCATTTCAGCGCCGAAGTGACCGCCTTTCTTGGTGGCGACTTCCAATACGGTCTGCTGGACATGTGAGAGCACATGTGAG
AGGCCATGAAACGAGAGAGACAGCGTGTTTTACTGGCGTTTAGGCGTTCAGTGACGCAAGATAGATACGGGTTACTAGAC
TTATACATTCACATGATTCATAATTTGGCTCAGCACGTTTTTACTTATCTAGTACGGAGTAGAAATCGGCTTGTTAACAA
GTGTCAGTGTTAATGCCGACTTTAACCGTTTACAATCTGCCTTATTCTGCCTCGTGACAAACTCTATCTAGAGCCGAACT
CGGCCAATGAAGCTTACGCTAATCAATTCTTGCCACAGCCTCTGGACCCGCTGTGTTGCCGGATTAGAAGCGTCTGTCGG
CAGAGATTGGGCCCGCGTGTCGGCAAGTCTGCTTAGTCATCATGGAGACGAGAGAGGGCATTAAGACAACCCTGCAAGCC
CCAACGTCGCTCTGCCCAGGTGCCGTCTCCGCACCTCACACACGCAACCGACGCAGACGAGATCGACCATGGCCGCCATC
ACGCACGAGGAGTCTGCCTCATATGCGGCGTCGGGCTACGGTGGCCGCATGGGCTGGGGCGCACGCCCGGCCCTGGTGCT
GATCGACATGTGCAAGGCGTACTGGACGGCGGGCTCGCCGCTGGACCTGTCGGCCTTTGCCGAGGCCGTGGCCGTGCCGG
AGAGCGCGGCGCACCTGGTGGCGGCGGCGCGGGCAGGCGGTGTGCCGGTGCTCTGGACGGCGGTCGAGTACACGGACGCC
GACATGGCTGATGCCGGACTCTTCTGGCACAAGGCCAAGACGCTGGCCGTCTGGCAGGTCGGCGGCGCGCTACATCGCCG
TGGCCTCGCCGACTGGGTCAGTCCGGACCTCACGCCGGGGCCCCGTGACGTCGTGGTCAAGAAAAAGTACCCCAGCGGCT
TCTTCGGCACCACGCTGGCGACCGAGCTGCAGTGCCGCAACGTCGACACGGTCGTGCTTTGCGGCGTCAGCACCAGCGGC
TGCGTGCGCGCAACCACGCTCGACGCCATGCAGTATGGCTTCCGTCCAATGGTATGTTGTCTTTATGGGTTCCGATTGGG
AAGCATTTCCTTCCTTGTTTCCTTTTCTTGTTTCCTTTTTCTCGTTCTTCCCGCTAACAAACAGGTCGTTGCATCGGCAT
GTGGAGACCGCAGCAAAGCCATCCAGGAGGCCAACCTGTTCGACTTGGACTCCAAGTACGCCGATGTCGTCACCGAGGAG
GACGCTGTAGCTCATCTGAAGGCAGGGTGGAAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62