GenePrediction:GLEAN_2423 Details

Name: GLEAN_2423
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1040372..1042013 (+ strand)
Length: 1642
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1040372..1040688 (+ strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_140:1040756..1042013 (+ strand)
Length: 1258
>GLEAN_2423 class=GenePrediction position=GCSC_140:1040372..1042013 (+ strand)
ATGGGCCACTCTGAGGCTGCCGAGAAGACATCTGCGCTCAGCATGGGCCCCGACGATTCCGCCGGCAGCGCCGAGTCGGT
GCGCGGCGCCCAGACGGAGCTGACCGAGAAGTCCGGCTGGATGCAGCGCGTGGCGCAGTTTGGACGCGTCCAGGACGGCG
CGCCCGAGCCGGCCAACAAGACCTGGCTTCAGAAGCTGGCCTCGTTTGGCCGCGTCGAGGTCAATGGCGTCACGCCCATC
CCGCTGGAAGAGCGCACCGTCACCAAGACGGTCAACATCTTCACTCTGTGGGCCTGCATGAACGCGAATATGCTGCCGTA
GGTGTTTTTCATCCATATTTTTTCTTTCTTTTTTTTCTTTCTTCTTTTGTCGCTGACCTACTAGAATCTCATCTGGCATG
CTGGGCCCGTCGTACGGCCTCTCCATCCGCGACTCGTCCCTCGTCATCCTCTTCTTCACTCTCCTCACCGCCGTCCTGCC
GGCCTATTGTTCTACTCTCGGCCCCAAGACCGGCATGCGACAGATGATCCTCGCCCGCTTCTCCTTTGGCCGCTACCTCG
TCGCCGTGCCCGTGCTGCTTAACCTGGCCACCCTCACCGGCTTCTGTGTCATCATGGTTGCCATCGGCGGCCAGTGCCTC
TCAGCCGCCGGCAACGGCGACCTCAGCCCCGATGTCGGCATCGTCATTGTGGCCATCCTCGCCCTCGTCATCTCCTTCTG
CGGCTTCCGCGTCCTGCACGTGTACGAAAAGTACGCCTGGGCCCCGGCCCTGATCTCCATCATCATCGCCGTCGGCTGCG
GCGGTTCCGACCTCAAGAAGCAGTCCGTTGCCGAGCCTTCGACAGCTTACGGAGTGCTCTCTTTCGGCATGATCGTCGCC
TCCTACATGATCCCCTGGGCTTGTCTGGCCTCCGACTTCACCACCTACCTCCAGCCCCAGACGAGCTCCCATCTGATCTT
CTGGTACTCATACGCCGGCTGCGTCATCCCCACCGTCTTGCTCATGGTTCTCGGCGCTGCCATGCAGGGCGCCGTCGCCA
ACGTGCCCTCCTGGACTGAGGGCTACGACCAGAACAATGTCGGTGGCGTCATGGCTGCTATGATGGGCAGCACCCATCGC
TTCGGCAAGTTCGTCACCGTCGTGCTCGCCTTCTCGCTGCTCGGCAACATCGCTGCCACCAGCTACTCCATCACCCTCAA
CTTCCAAATCCTCATCCCCATCCTCAAGAAGGTCCCCCGCTACTTCTTTGCCATTCTCCTCACTGCCATCGTCATCCCCG
TCGGCATTGTGGCTGCCTCTAGCTTCTTCGACAGTCTCCAGAACTTCATCTCTATCATCGGCTATTGGGCTGCTGCCTTT
GTCGCCATCATGCTGACCGAGCACGTCGTCTTCCGTCGCTGCGATTGCTCGCGCTACGATATCGACGCCTGGGACACTTC
TAGTCTTCTTCCTCCCGGTATTGCTGCGCTTTCGGCCGGCGTCTGCTCTTTTGGCCTGGTCATTCCTGCTATGTCCCAGA
TCTGGTACACAGGCCCTATTGCTGAGACAACTGGTGATCTTGGCTTTGAGTTTGCCTTTGTCCTCAGCTCGTTACTATAT
GTGCCGTTCCGGCTGATTGAACAAAGGGTTTCCGGCCGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62