GenePrediction:GLEAN_2425 Details

Name: GLEAN_2425
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1047149..1048032 (+ strand)
Length: 884
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1047149..1047381 (+ strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_140:1047451..1047561 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_140:1047651..1048032 (+ strand)
Length: 382
>GLEAN_2425 class=GenePrediction position=GCSC_140:1047149..1048032 (+ strand)
ATGGCCGTGTTTTCTCGTCTTCTCCGCAGCACGACGGCGCTGCTGGCCATCGGATCGGCCGTCGCCAACCCGGTTGAGCG
CCGTGGCACTGTCGACTCGGATGCGATCGTCGGCTTCGCCCAGGCAGTCCCCAGCGGTACCGTCGGCGAGGTCTACCTGG
CGTATCAGCCGTACCTTAAGGTCGTCAACGGCTGCGTGCCCTACCCGGCCGTCGATGCCGAGGGCAACACCAAGTAAGAA
ATGAACAACCGACGACAAGTTCGCTGGGATGAGGCGAACTGTTTGCTGACATATGGCATTAGTGCCGGCTTGAAGACGTC
GGGCTCCAGCAACGGTGGCTGCTCCAGCAGCACGGGCCAGATCTACGTGCGCGGCGCCACCTACGGCAAATACTATGCCG
TGATGTACTCTTGGTACGTACAGACTGGTGGATGAGGATGGGGACGAGGATGGCTGGAGATGGGAGACAGACGACAGATG
ACAGACTTGCTAACTTGCACAGGTACATGCCCAAGGACGAGCCCTCGGATGGTCTCGGCCACCGCCATGACTGGGAGGGT
ACCATTGTCTGGCTGACCAGCGGCACCAGCACAACGACTGGCAACATCGCCGCCGTCTGCCCGTCTGCACACGGAAAGTG
GGATTGCACTACCGACGGCTATACCTTGTCCGGCACCAAGCCACTGATCAAGTACGAGAGCGTCTGGCCCGTCGACCACT
CGTGCGGCTTGACCACCACCGTCGGCGGCACCCAGCCTATGATATCCTGGGAGGAATTGCCCACCGTGGCCCAGGACGCT
CTCACCAACACCGACTTTGGCGACGCAAACGTGCCGTTCAAGGATGCCAACTTTGATACCAACCTGGGCAAGGCTACGTT
TTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62