GenePrediction:GLEAN_2427 Details

Name: GLEAN_2427
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1050342..1057514 (+ strand)
Length: 7173
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1050342..1051863 (+ strand)
Length: 1522
Type: CDS
Source: GLEAN
Position: GCSC_140:1051921..1053423 (+ strand)
Length: 1503
Type: CDS
Source: GLEAN
Position: GCSC_140:1053481..1057514 (+ strand)
Length: 4034
>GLEAN_2427 class=GenePrediction position=GCSC_140:1050342..1057514 (+ strand)
ATGGATTCAGCAAATGCTGAAAAACGAACGGCCCGGCTGACCAAAGTGCTGCATACATTCATCCGAGGAACCCGACCAAT
TTCGACGCCGCACGATGCCAAACTCTTTTTCGAAGCCGTTTGCGGTCAGCCCAAGCCGGTGGTCTGTCTGGAGACGATCC
TTGGTCAGTCCAAGGGTCTCGATACGGTGCACAAGAGCGTGAGGGCCAGTTCTAGCGCGCAGTTCATCACAGGTCAGGTG
CTTCCTTTTCTCGCGTATATGGCACACCCGGACATCAAGGCGATGTACGAGGGTCAACTTCTCGACAAGATCATCGTGGC
CGTCGTCGATCCACCGATGACATGGAAGGCCATTGCTCAGCTCTGGGCCGACACCGGCTTTGTCGACAAGGAGGACAATG
CAGTGACGTTTGCGTGGCTGTGCCTCGAGATCGTCAGCCATGCCGGCACACAGTTGGCACTAACCGTGGTGGACATCAAG
GATGCCCTTGCACAACGGTCGCTAGTCAAGCACGCCAGCAGCAAGGCGCGGAGCATCGGGTACCGCGTGCAGAAGGCGCT
GCAGATCCGGTTCTCGGACCGGACGGTCGATCCGGAGTCGATGGTGACGGCTGGCGGACGTCACGACAATGACTTTGGTG
ACTTTCGCGACATCTCCATCTACCCGACGACGGATGAGTTCTCGTCGACGCAGCGGCCGTTTTACCGACGAGCGGCCGAG
ATCGCGCGCCTGGACGCGAACACGCGGGTAGGCGGCCATCTGGACAACCAATTCCGGCTCCTGCGCGAGGACATGTTGGG
CGGACTCCGGGACGACATCCGCATCGCGATCGGCAAGACCAAGGGTCGGCGGCCTGCGCAGATTCTGGACGGTCTCGAGC
TCAGCAGCATCGACACGGGAGACGTGCAGCGGGCCCGCATCTGTGCCGTGGACGTGCTCATCCACGGGAATGGGCTGAAC
ATGCTGCGCAAGATGTCGCCGAAGAAGCGCAAGGAGCATCTGAGAAACACGCCCAGGCTGCTGCGAAACCAGGCGTTTGG
GGCGCTCTGCTCGCAGGACGAGATCGTGGCGTTTGCTTTTATCGTCCGCGACGTCGACAAGCTTTCGATGGATCCGCCGT
TGGTCGGACTGCAGTTCTCGACCAGCCAGATGCTGATGACGGCACTGTCAGCATTCCACAGCGGCAGGGAGCTGCGCTTC
GTGCTGGTCGACACGCCCGTGTTTGCCTACGAGCCAATCCTGGACCGGCTCAAGAAGATCGTCCAACTGCCTCTCGAGAC
GGAGCTGCTGCAGCTGCAAGGTGGCGACAACGACGACGACGAGGCCGCCTTTTTCGAGGACCTGGAAGACGCCTTTGCGC
CTTCCTACCATCTTTCAAGCTTTCTCGAGAGCTGCCACGCGAACTCGGACCGCGGTATGACGATCCGTGTCGATAAAAAA
GACTACAATCTCGATGCTGCACAGCTCAACGCGCTTGCATATGCTTTGGAGAAGCCACTCTCTGTCATTCAAGGACCACC
TGGTACGTCAAAGCCCGATAAATGAGATCGGTCTCGCTTCTAACAGTCCCTAGGCACAGGAAAGTCCTACATAGGAGCAC
TGGCAGCGAAGAAGCTGCTCGAAGATCCGTCAACGCGACTGCTCGTGCTCGCATACACCAACCACGCGCTCGACCAGTTC
CTGGAAGATCTCATAAACATCGGAGTCTCACCTGGCATCATGACACGGCTGGGCTCCAAGTCGACGTCCACAACGTCCCA
TTTATTGTTCAACAACGGCGTCCGTTCGAGCGACAGCTGGCGTACCAAAGAAGCACAAAGCAGGCTGTACAAGCTGAGAA
CGGAGCTCAACGATGTCCGACCTGGACTAGAGAAATTGTTTGCGATTGCGAAAACACGGCCGTCGCATGATGCGATACTA
AACTACCTCGAATTCGCCGAAGACGCCAGATCCCAAGCGTTCTGGGTGGCCTTTCAGGTGGAAGACGAAGACGAAGACGA
AGACGAAGACGAAGACGAAGACGAAGTCGGAAACAAAGACGAAGACATATACGGTAAATTCCAGGTAGTAACAAAGACGA
AGAAGCCGTTCTCGGCCGTGACTATTCTAAAAAAATGGACGAGACAGAAGACTCCAGGCCCCCTAGCAAAGCATATGAGG
CTCGACAGCGAATGGATCTGGGAGATTCCGATGCAGCAGAGAAAGCAGAAAATGGTTGAATGGGCTGAGGCTGTGCGCGC
AGAGAGACGGGAAGAGCTGTGCGACCGGATCGATATGTTCAACGAGATGCAGACGGAGGTCGAGACGCTGCACAACCAGG
CGCGATGTGCGTACATCCAGACGATGCGGGTGATTGGCTGCACGACGACGGCAGCGGCCATGTACGCGGCGCTGTTGACG
GCGGCGATGCCGACGTGCGTGCTTGTCGAGGAGGCCGGCGAGATCCTGGAGTCACACGTGCTGACAGCTCTATCGGGCAC
AACGCGACAGCTGATCTTGATCGGTGACCACAAGCAGCTGCGGCCCAAGTGCAAGAACTACGGCTTGAGCGTGGAGCAGG
GTGGCGGCTTCGACCTGAACCGGTCGCTGTTTGAGCGGCTGATCCTGCAAAAGCACCCACATGCGACGCTCTGCACGCAG
CACCGCATGGCTCCAGAAATCTCGCGATTGGTGCGCTCGATGACGTATCCGGAGCTGCAGGACGGCGCCGGAACAGCTGG
CCGGCCAGCCATCCGGGGCCTCCGCAGACGGGTGGCCTTTGTCAACCATGACCACGCCGAGGAGGTTGATGCCGGGCTTC
AGGACCGCAACGATGGCGGCCAGCCGACCAGCCGGCAGAACCGGTTCGAGGCCCTCATGGTACTCAAGCTGGTCAAGTAC
CTCGGCCAGCAGGGCTACAAGACCGACGACATGGTCGTTTTGACGCCGTATCTCGGCCAGCTGCGGCTGCTGCTGGAGAT
CCTATCGACGGAGAACGACCCGATGCTCAGCGATCTGGACTCGTATGAGCTGATCCAGGCCGGCCAGCTAACCGATACGG
CCAGCCGCCTGGACCGGAAGAAGATCCGCATCTCCACTATCGGTTTGTGTCTAGCCCCGTGAAGAAGCAGAAAGGAAGAC
TGACTGACGTGGCCGACAGACAACTACCAGGGTGAAGAAGCCGACATTGTGATCGTGTCGCTGACGCGCAGCAACAGCAA
GGGCGAGATCGGCTTCATGAAGGCACCCGAGCGGCTCAACGTGGTTGTGTCGCGGGCCCGCAACTGTCTGGTCATGTTTG
GCAACATGGACACGTTTATGAACTCGCCACAGGGAGAGCCTGTCTGGCGGCCTTTCTTCCAGCTGCTCAAGGACGGCGAC
CAGCTGCGAGACGGCCTCGAGGTGCACTGCGAGCAGCACCCAGAGAACAAGGCGCTCCTGGCGGAGCCGCAGGACTTTGA
ACTGCGCTGTCCTGACGGTGGCTGTACCGAGCCCTGTGACGGTATGCTGAAGTGCGGGATGCACAAGTGCCATAGGCGCT
GCCATCGGCTGGCGGAACACAGCAAGATCACGTGCACACAGCGGATAGACAAGACGTGCGAGAATCAGCACACGTACCAG
GTGTTGTGCAGCGAGGACAAGCAGCGGTGTAAGCAGTGTGAGCGCGACGAGAACGACATGCGGCGTCGCGTGAAGCGGGA
TCTCGACATCGAAAAGGCGCGTCTGGACCAGCAGAAGAAGTACCAGGCCGAGCTGCAGAGCATCCAGGACGAGATCGACC
ACCACAAGCGTCTGCTGCGGATCGAGCAGGAGCAGAAGCAGCAGGTGGCTGATCTGGACAAGAACAAGGCTGAGCTAGAC
TCGCTAGTGAAGGCGAAACAGAGACGAGAAGCTGACGAGAAGAAAAAGAAGAAGGACAAGGCAGCAGCAGAAGCAGCAGC
AGCAAAGCCGAAGACGGCTACGGCCAAGAAAGAGAGCGAGCCAGCCAAGCCTGGAAGTGCCCAAGAGGAGTGGGAGTACC
TGAAGAGGGAGGAGCTGGCATGCAGTGACACGCTGGATTCGCTGATGAGCCTGATCGGACTCGAGGACGTCAAGCGCCAG
TTTCTCGGCATCAAGCAGACCGTCGACACGGCCAGGCTCCAGGGCATCTCGACCGCGTCTGAGCGCTTCGGCTGCAGCAT
GCTCGGCAATCCGGGCACCGGCAAGACGACCGTGGCCCGGCTGTATGCCCAGATGCTAACGTCCATGGGCATCGTGGCCG
GCACCTGCTTCCGGGAGACGACCGGGTCCAAGATGGCCAGCATCGGCGTCCCGGGCTGCCAGAAACTGCTCGACGACGTG
CTGGAGCAGGGCGGCGGCGTCATCTTCGTCGACGAGGCCTACCAGCTGTCGTCGGGCGCCAATGCGGGCGGTGCGGCCGT
GCTGGACTTTCTCCTGGCCGAGGTCGAGAACCTGAATGGCAAGATCTGCTTCGTCCTGGCCGGCTACGCCAAGCAGATGG
AGTCCTTCTTCGCCCACAATCCCGGCTTCCCCAGCCGGTTCCCCCGCGAGATGAAGTTTGACGATTACAGCGACGTGGAG
CTCCTGCGCATCTTGGAGATGCAGGCCGACAAAAAATACGGTGGGCGAATGAAGGCCGAAGACGGCCTGCGTGGGCTCTA
CTGTCGCATTGCTATGCGCCGGCTTGGCTCCGGCCGTGGTCGTGAAGGCTTCGGCAATGCCAGGGCCGTCGAAAACGTTC
TCGCCCGCATCGGCCGCCGACAGAGCGCCCGGCTTCATCAAGAACGTCGTGCTGGCTGCAAGCCGGATTACATGATGCTG
ACTAAGCAAGACATCATCGGCCCCGAGCCGGCCGGTGCCCTTAGCACGTCGGCCGCCTGGACCAAGCTGCAGAGCCTCGA
GGGGCTGCGCTTGGTCAAGGAGTCGGTCCAGACGCTGGTCGACAGCATCCAGACCAACTACCAGCGCGAGCTGAAGGAAG
AGCCGGTGCTCGAGTATAGCCTAAACCGCGTCTTCCTCGGGAATCCCGGCACCGGCAAGACGACCGTGGCCAAGCTGTAC
GGACAGATTCTCGTCGACCTCGGGCTTCTGTCCAACGGCGAGGTCGTGGTCAAGAACCCGTCTGACTTTGTGGGCGCTTA
CATTGGGCACTCGGAGAAGCAGACAAAGGGCATCCTGGCAGCAACAGCCGGAAAGGTGCTCGTCATCGACGAAGCGTACG
GGCTCCACGACGGCGGTGGTGGTGCTGGTGGCGGTGGAGGCGGCTCCTCGGGTGGATTCAAAACGGCCGTCGTCGACACG
ATCGTGGCCGAGGTGCAGAACACGCCTGGCGAAGACCGGTGTGTCTTGCTGCTGGGCTACAAAGACCAAATGGAGGAGAT
GTTTCAGAATGTCAATCCAGGACTCAGCCGGCGCTTCCCGCTGAGCTCGGCCTTTGTCTTTGAAGACTTCAACCAGGATG
AGCTGGGCCGTATCCTCGACCTCAAAGCCAAGGGCCAGGGCTTCAGTCTGGCCGCTCGTGGACGCCAGGTTGCCCTCGAA
ATTCTCGATCGGGCACGCAACCGGCCCAATTTTGGCAACGCCGGCGAGGTCGACATCCTGCTCAACGATGCCAAGATGCG
CCACCAGAAGCACCTCTCGGCCGGTCGGACGCAGCAGCGGACAACTTTGGACGCCGCCGCCTTTGACGAGGATCACGACC
GGACGACACGCTCCGAGACCGACGTGGCCGCGCTCTTCCATGGAACCGTCGGCTGCGACCAGATCGTGGCCACACTGCGC
GGGTACCAGCAGACGGCCCGGTCGATGAAGGAGTTTGGACTCGACCCCAAGGAGGTCGTCCCATTCACCTTCCTGTTCCG
CGGGCCTCCTGGCACTGGAAAGACAACGACGGCCCGCCGTATGGGCAAGGTCTTTTACGACATGGGATTCCTGGCCAATG
CCAGCGTCCTTGACACGTCAGCCTCGGACTTGATCGGCCAGTACGTCGGCCAGACCGGCCCCAAGGTTCGCCAGCTGCTC
GACAAGGCTCTCGGCCGCGTCCTGCTCATCGACGAGGCTTATCGCCTGGCCGAGGGCCACTTTGCCAAGGAAGCCCTCGA
CGAGCTTGTCGATGCTGTCACCAAGGAGCGCTACCATAAGCGCCTGATCATCATCCTGGCCGGCTACGAGGACGACATCA
ACCGCCTGCTGACCGTCAATCCGGGCCTCAGCAGCCGCTTTCCCGAGGTCGTCGAGTTCAAACCGCTACAGCCCCACGAC
TGCTTCTCTCTGCTACAGACGACGCTGGCAAAGCAGCAGGCGAAACTGGCGAAGCAGAAGAAGAACGCCCAGGGCGCTCA
TCGAAACGCCAGTATGGACATGACCTGCCTCACCGACCCGGCCGCCCTGTTCAAGGCTGCTGTCATCACCCTGTTTGGCC
AGCTGTCCGCCCTGACTAGTTGGGCCAACGCCCGCGACGTCGAGACGCTGTCTCGGTCCGTCTTCCAGTCCGCGCTCAAG
GCCAGCTCGGAGTCGTCTAGCACGTCCATTGTCTTGTCCGAGGAAACCGTGCTCGCCGAAATAGAGACCATGCTGCGCGA
GCGGAGCAGTCGAGAGAAGCTGCAAACCGTGTTCCAGAAGCCCTCCCTGCCGATTTCGGACCTGCCCATACAGCCACCAC
AGGCACCCCCTGCATCACATTCTGCTTCCGCCTCTACGTCTGCTGCTGCTGCTCCTCCATCTCCTCCGCCACCCCCTGCC
GCAGAAGAAAAGCCCGAGGAACAAGCGTCTGGGCCAACCAGAGATGCCGGGGTCAGTGACGAGGTCTGGAACCAGCTGCA
GAGAGACGCTGCAGCCGAGCGTGAGCGCGAGCAGGAGTACTTGGCAAAGCTCAAGGAAAAGGACCAGCTGGATGATGCGC
TAAGAAGTGCGCTGGAAACGCGCATCATAGACGAACTGTTAGACGAGGACCTACAGAAGAGATTAGCAGAGGAGGAGCGG
AGGAAAAAGAAAGCGGAGGAGGACGAGAAGCTGCGACAACGCATCGTCCAGGAGCTGCTGGAAATGGAAAAGAAGAGAGA
GGAAGAGAAAAAACTCAGGGCCAAGTTGTCCAGGATCGGGCGCTGTCCGATGAATTATGCATGGATACCGCAGGCGGGCG
GCTGGCGTTGTGCCGGAGGGAGTCATTTTGTCACCGACCAACAGCTGCTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62