GenePrediction:GLEAN_2428 Details

Name: GLEAN_2428
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1058294..1060577 (+ strand)
Length: 2284
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1058294..1058552 (+ strand)
Length: 259
Type: CDS
Source: GLEAN
Position: GCSC_140:1058606..1058673 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_140:1058725..1058896 (+ strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_140:1058963..1059058 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_140:1059111..1059373 (+ strand)
Length: 263
Type: CDS
Source: GLEAN
Position: GCSC_140:1059440..1059533 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_140:1059591..1059765 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_140:1059822..1059958 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_140:1060023..1060275 (+ strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_140:1060340..1060577 (+ strand)
Length: 238
>GLEAN_2428 class=GenePrediction position=GCSC_140:1058294..1060577 (+ strand)
ATGGGGTCATTGAAGAATTTTTTCAGTGTCGGTGTTGGCGGAGAACTTGGGGCTACAGTACCTGAGAGCTCGGAAAATGT
GTCTGATGGAAGCCTGAAGTATGTTGGTGAGAAGGGTGGCAACGATGCCCCGTTGACATACCAAGAGGCATCCGGCGCCC
CTATTGAGCACAACTCACCTCTGGGCTATTCTGTCGGCCCAGTCACTATTGTACTCATCAACGTCACTATGATGATTGGC
ACCGGCATCTACTCTACGCGTAAGTGTGCACGGGTTGAGGCTTTAGTGGGAACGATTACTGACCTTTCTCAGCATCTTCC
ATTCTTTCGGGCACCGGCTCCGTCGGACTAGCTTTGATCTACTGGACTCTCGGCTATCTGGTACGATTGTATCTTGAATA
CCGTGACTATAGTCAACTGACTTGGATGTAGATATCTCTTGCATCGGGCGCCGTCTATCTCGAATTCACGGCATACTTTC
CGAGCCGGTCCGGATCCGAGGTCGTCTTTCTTGAGCAGGCCTACCCACGACCAATGTGGTTCTTTCCCACGACTTTTGCT
GTCCAGAGCGTTCTTCTGTCCTTTGGAAGTGCCAATGCAGTCGGTGAGTATAACCCTTCCACGCTCATTCTCAACCCAGT
GCGATGCGGTGGCTGATCTGATTGCATAGTCCTGGCCAAGTACCTGTTTGCCATTTCTGGCCACGCCGGTTCCAATTGGC
ATGTCAAAGGTGTGGCTATTGCTGGATACACCATTGCCGTTTTGTGTAAGCGCAGCCAGCCTCAACTCGTCTTGATGTCT
TTTCTAATTACACGAAGCCTTGGTCTTTAACACAAAATACGCGTTTCGCGTTTCCAATCTCATCGGCATCGTCAAGATCT
CAACGCTTCTGTTCATTATCATCACTGGCTTTGTCGTCCTCGGTGGTAACACATCGGTCAAAGACCCCAAAGCCAATTTC
CGCGACGCATTCAAAGGCACCGGATCGGCGGGTGCATATGGTGCCACGACGTCACTTTACCGCATTATTTTCTCCTACGG
CGGATACAATAATGCATTCAATCTTGCTAATGAAGTAAAGGTATGTTGTACTTCCCGGTGATAGTTCTGCTGTCAGGTTC
AATTGCCTAATCTGACATTGGTATAGAACCCTGTAAAGAAGTTAAAGGTCTATGCGACTGCTGCTCTAACCATTGTGTAC
ATCCTGTATATGTTGGCCAATGTGGCATGGCTTTCTGCCAGTAAGACTTGTGCCATGAAACTCCGCTCGAGTCGCAGCCT
GACTGATTCCACCACAGTTCCCAAAGAAGAGCTGCAGACATCCGGCCTCACAGCTGCCAGCCTCTTCTTCACAAAGGTTT
TCGGAAACAGCGGCCACGTCCGAGGACTGAACTTTCTGATAGCCCTGAGTGCATTCGGAAACATCATGGCCGTCATTATC
GGCTTGTCCCGCAAAATCAGAGAGTCTGGACGGTGCGTAAACTTTTGTCTTTGATTTTATGCCGGAACTGGGAGCTGACA
ACAGACAGACAGGGCGTTCTACCATGGACCAGCTTCTGGGTAGGGACCAAGCCCTTTGGAACACCCATTGGTCCCTACTT
TGTTGTATGGGGCTTGACCATGTTGATTATTTTGGCCATCCCCTCGGGAGATGCTTTCAACTTCGGTAGGACATACAGAG
AGGGAAGACTTGCAGCGAGCTGTAGTGGTATCAGCTAACAATTGAATAGTGAACGATCTGAGCACCATTCCCAGCGCCGC
CTTCAACTTGGCCATGGCAGTCGGTGTTTTTGTCGTGCGATGGCGCCGCAAACGTGCTAATCTTCCTGAGCCCGAGTTCA
AGGCCTACAACTTCGTCGTAATTTTCAACATCCTCGTTCAACTATACCAGCTCATCATGCCTTGGTATCCCCCCTCAGGC
GGCATCAACGATGGCGACGTCAGCTTCTTCTATGCAACCTATGCAGTGACTGGAGTTGGAATGTAAGTGGACTACCTCCT
GATGTGCTACTTTGTGTGCCCACCTGGTTCTAATGATGATTGATAGCCTGATCGCATGTGGATCTTACTACTACTTCTGG
GTCAATCTGCTACCGAGATGGAGGGGCTACAAGCTACGCCAGGAGATTGTCACGTTCGACGATGGTGCACGGAGCCATCG
GATCACCAAAGTTCCGGTCAGCGAGGCTGAGCAATGGGATGCGGATCATGATGCTACCGGGCGTCTGCGCAATACGTACG
TCGCTGAGTCCGAGGGTCATGAAAAGGATTCCCATGATGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62