GenePrediction:GLEAN_242 Details

Name: GLEAN_242
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:492800..494052 (+ strand)
Length: 1253
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:492800..492944 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_167:493016..494052 (+ strand)
Length: 1037
>GLEAN_242 class=GenePrediction position=GCSC_167:492800..494052 (+ strand)
ATGACGCTCGCGCGGCCGGTGCGAGCGCTCATAGCAGCGGTCCTGCTTGCCTGGTGTCTGTTCATCTTCCACCTGATGTC
GCCGTCGTCTGGGCGAGGTCCAGCCGAGGAATTGCAGTCGTTTGAGCGAGACCCCAACCTAGATCGTACGTATCCCGTAT
CTGACTGATGTGTGCGGGCTGCTGGCCCTGACCGCTGGCTGACTTGTTTTGCGCAGCGACCGACGAGCCGACCGGGCTGC
TGCACCGGACGTCGAGCGGCTACCTGCCGGGGCCCGAGGGCACGGAGCGCATCAACGCCACGCTGCTGGCACTGGTGCGG
AACGAGGAGCTGGACGGCATGCTGCAGGCGATGCAGGACCTGGAGCGGACGTGGAATCACAAGTTCAACTACCCGTGGAC
CTTTTTCAACGACGTGCCCTTCTCGGACGAGTTCCGGAAGCGGACACAGGAGGCGACCAAGGCCGAGTGTCGCTACGAGA
TCATCCCGGCCGAGCACTGGAGCATTCCGCCGTGGATCAACCAAGACCTCTATGCCGAGTCGGTCAAGATCCTGAAGGAG
AACGATATCCAGTACGGCGACAAGATCTCGTACCACCAGATGTGCCGGTGGAACAGCGGCATGTTCTACCGCCACCCCGC
GCTCGAGCACACGCAGTACTACTGGCGCGTCGAGCCCAAGGTGCACTTCTTCTGCGACATCGACTACGACATCTTCCGCT
ACATGCGCGACCACAACAAGACGTACGGTTTCACCATCAACCTGTACGACGCGCCCAATTCGATCCCGACGCTCTGGCCG
GAGACGGTCAAGTTCATGGCCGAGCACCCCGAGCACATCCACCCGAACAACGCGCTGGACTGGCTGACCGATCGCGTCCG
GCGTCCCAACCACAACAACGGCGCCAACGGCTACTCGACCTGCCACTTCTGGACCAACTTTGAGATCGCCGACCTCAGCC
TCTGGCGCAGCAAGGCCTACGAGGACTACTTCAACCACCTCGACCGCGCCGGCGGCTTCTTCTACGAGCGCTGGGGCGAC
GCCCCGGTCCACAGCGTCGCTCTCGGCCTCTTTGAAGACAAGAGCCGCATCCACTGGTTCCGTGATATCGGCTACCAGCA
CATCCCCTTCTTCAACTGCCCCAACTCGCCCAAGTGTCACGGCTGTGTGACCGGTCGCTTCACCGACGGCGAGGCCTGGC
TCAATAAGGAGGACTGCCGGCCAAACTGGTTCAAGTATGTCGGCATGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62