GenePrediction:GLEAN_2435 Details

Name: GLEAN_2435
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1096773..1100099 (+ strand)
Length: 3327
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1096773..1096795 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_140:1097339..1098017 (+ strand)
Length: 679
Type: CDS
Source: GLEAN
Position: GCSC_140:1098076..1099740 (+ strand)
Length: 1665
Type: CDS
Source: GLEAN
Position: GCSC_140:1099815..1100099 (+ strand)
Length: 285
>GLEAN_2435 class=GenePrediction position=GCSC_140:1096773..1100099 (+ strand)
ATGGCCAACGTGGCTCGCTCGAGGTAAATACCTCGCAATCTGGAGCCTCGCTAAGTACCTAAGCAGCATCAGCTCCAGAG
CTCCTACCACCCTTTTCGCAGTCTGAGGCTGTTTTTCGTCCTCATCGTTGGCAGCCCGTTTCCCTCGACTCTGCGCAATC
AGAGCCACCGCGCCCTTGTTCGTGTTCCCATCGCTCGTTTTTTCCGGTACGTTTCATCTCCTGGTACGACTGACTTTTCT
GCCGGTCTGTCTCGCTTTTGCTTTTGGCGGCCGCTATTCCAAGCGACTGCAAAACACACATTTGCGCTCCCTCTGGCAGC
TGCTCGGGCTCCGCTGACCCTCGTTCACAAGCTATTCTTGCTGATTCGTGCTCTGTGCCATATATGCTGTTCGTTCTTCC
CGCCCCCTGACGTTTTCTATTTTGTCCTCGTCTTGTCGTCCTTTTCCCTTCACACCGTCTACCAACAGCACTGTCTCTCG
TCCATAAAACACTAGCTTTTGTTGCGACCTTGGCACTAACATATTTCCTCATGCTGGTCATCGAAGACCTCAAAACGCAC
AAGAAGACGTGGCAGTCTACTCCTGATCGACGGCGTAGCGCAGTCAGCAGCAATACCGTTCCCTCCTCGACCATTAGCAG
AAAACACAGGCCACTCCGACGAAAAAAAGAAGTTTGCCAGCAGTTGGCGTGCGCCGCCCGGAATCGTCGTTATGAAGTTC
GGCGACCAGCTGCGGTCCAGCATCATTCGCGAGTATGAATGGTCCTATCTGGACTACGAGGGCCTGAAGGACAAACTGCG
GACGCCCAGCGGACCGCTTGTTGCAGTCGACGCAGCCGAACAGCAAGTGTCAGCGGGCGACAATGGCGGCAAGAAGGCGG
CGAAAAATAAGAAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGTATTTCCACAGATGCGGCGGGAATGGACCGAGGAA
GACGAGGCCGGGTTCGTGACAGTGCTGGAGAACGAGTTGGAGAAGGTGCACCAGAAGCAGCAGGTGAAGGCCATCGAGAT
CCAGCGGATGATTGCGGTCAGCGAGCGTGAGGTCAACGATGTGGTCAACCGGTTGCGCGAGCGTGGTACTGGGCCGGGGC
CAGCCGAAGAGGAGTTTATACTGCTCGAGGAAGACCTCAGCGACATCATTGCCGACGTGCACGACCTGGCCAAGTTTGTG
CAGGTCAACTACACTGGCTTCTACAAGATCATCAAGAAGCACGATGTGAGTCTGCTGTCCTTCCTGTTCTCCCGCACGGT
TTCCGGTCCTCTAATGCGAATAGAAAATGACGGGATGGCACCTGCGGCCAGTGTTCGACACGCGATTAAAGGCCAAACCG
TTCTACAAGGAGAACTACGACGCGTCGGTGGTGAAGCTGTCAAAGCTGTACGACCTGGTGCGGACACGCGGCAACCCGGT
GACAGGCGACAGCAGCGCGGGCGGGTCGCAGGCGAGCTTCATCCGCCACACGACCAAGTACTGGGTGCACCCGGACAACG
TGACGGAGCTGAAGCTGATCATCCTAAAGCACCTGCCGGTTCTGGTGTTCAATGCGAGCAAGGAGTTTGACCAGCAGGAC
TCGGCGATCACGTCGATCTACTACGACAACCCCGAGAGTTGGGACCTGTACGAGGGCCGGCTGAAGAAGACGGAGGGAGC
AGAGGCGATCCGGCTGCGGTGGTACGGCGGGATGCGGACGGAGACCATTTTTGTGGAGCGCAAGACGCACCGAGAGGACT
GGACGGGCGAGAAGTCGGTCAAGGCGCGGTTTGCGATCAAGGAGAAGAACGTGAACGCCTACATGCGGGGCGAACTGCTG
CCAGCGGCGATCTTTGAGAAGGCGCGCAAGGAGGGACGCAAGTCGAAGGCGGCGATCGCAGAAGACGAGCGGCTGGCAGC
CGAGGTGCAGTACTCGGTGCTGAAGAAGGGGTACCGGCCGGTTTGCCGGTCGTTTTACAACCGGACGGCATTTCAGCTGC
CGGGCGACGCGCGTGTGCGAATCTCGCTGGACACGGAGCTGACGATGGTGCGGGAGGACAACCTGGACGGGGTGCAGCGA
TCGGGCGAGAACTGGCGGCGAATGGACATTGGGATCGACTATCCATTCTCACAGCTGCCGCCGGCCGACGTGGAGCGGTT
TCCATACGCAGTGCTGGAGGTGAAGCTGCAGACACAGACGGGCCAAGAGCCGCCCGAGTGGGTGCGGCAGCTGATCTCGA
GCCATCTGGTGGAGGCGGTGCCCAAGTTTGGCAAGTTTATCCACGGCGTGGCGACGCTGTTTCCGACGCGCATCCACCTG
CTGCCGTTCTGGCTGCCGCAGATGGACGTGGACATCCGCAAGCCGCGGTCGCACGACTTTGGCATCCGGCGAACCGGACA
CTCGGCGACGACAGTGACGTCGGAGTCAGACGACGAGGACTTTGACTCGGATGACGAAGACGACAGCAACGAGACGGCGG
TGGTGTCAACACGTCGGCAGGTGGGAAACGGAAACGGCAGCAGTTCGCAAGCCGACGCGAGAGTGGACGTGGAGGACCAG
ACAGCCGACGGAAGTCCAGGCACGGCGACAGCTGGTGGCAGCGGACTGCGGGATCCGTATCCGGTGTACGAGTCGGAGGA
CGAGGAGGATGGCGAAGAGGATGGCGAAGAGGACGGCGAGGCAACGGCGCTGGAGGAGGCACGGCGTGTCGGTGGCTGGA
CGTACTGCTCGGCACTGCTGTCAGCGTATGGACGAGCAGCTGGCCGGAACGCGGCAGCAGTGGCTCATGCGCTGGTGCCA
CATCCACGTGGATCGGCCATCCCGCAGAACGAGCGGCTGCGGCAGCTCTTTGGCACGGCCGACGTGCAGACGAAGCGGTT
TCGCGCGCCCAAGGGCAAGAAGATTTACGTTCCTGTGCGGGTCGAGCCCAAGGTGTATTTTGCGGCAGAGCGGACCTTTT
TAGGATGGGTGAGTTTGATTTTGTTTTTGTCCTCTCGTTTGTCTTTCTTTTCTCTCCCACCTACCCCTACTAATCCTCCC
AGCTCGAATACTCCATCTACATTGGCACAATCGCGGCCACGCTGCTCAACTTCGGCTCCAAGCCCAACAGCCTCTCGTTT
GTGGTCGCCGGTGCCTTCACCTTGCTGGCCGTTGCATGCCTCGTCTACTCGTCCGGCATGTACTTTTACCGCAGCCAGGC
GATCCGCACGCGGCGTGCGTCGGCCAAGTTCTACGATCGCGTCGGTCCGTCGGTGCTGTGCGGCGCCCTGCTGGTGGCCG
TGATGCTGAACTTTGCCTTTGAGGGTCGGTCACGGAAGTTGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62