GenePrediction:GLEAN_2436 Details

Name: GLEAN_2436
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1103765..1104473 (+ strand)
Length: 709
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1103765..1103873 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_140:1103932..1104172 (+ strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_140:1104230..1104473 (+ strand)
Length: 244
>GLEAN_2436 class=GenePrediction position=GCSC_140:1103765..1104473 (+ strand)
ATGTCGCCCGGACTGTCTCTATACTCGGTCAAGGCGGTCATCATCTTGGCCGACGACGGCTCCCGGATATTCGCCAAATA
CTACACACCGCCCCACGTCGTTCCAGGAGGTAAGAAGGAAGATGAAAGAGTAGATGCGCGAGAGCCAGCTAACCGTCTCC
GTCTCAGCCCCGTCTGCTTCCATCGGCAACCCATTCCACGACGTCAAGTCGCAAAAAGCCTTTGAGAAGGGTCTCCTCGA
GAAGACGGCCAAGCAGAATGCCGACATCCTGCTCTATGACAGCCACATTGTGCTCTACAAGACCGAGTCCGACGTGACCA
TGTATGTGGTCGGCGATCTGGACGAGAACGAGGTGCTGCTGTACAATGTCATCCTGGCCATTCGCGACTCGCTGCACCTC
CTCTTAAAGTGGGTTACCCTGTCCTGTATCCGCCCGCCTGCTGCTCCCAACCGCTAACTATCCAGACAATCGATCGACAA
GCGCACGCTCATTGAGTGCTACGACCTGCTCGCCCTGGCCATGGACGAGATCATCGACGACGGTGTCATCCTCGAGACCG
ACCCCAGCATCATCATCACCCGGGTCAGCAAGGCGCCCAGCAAGGACGTCGACCTCAGCCGCATCGACCCCTTCAGCGAG
CAAGGCGTCAACAACCTGGCCCAGCTGGGAAGGGCCAAGCTGACCGATTGGCTGCGCCAGGGGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62