GenePrediction:GLEAN_2437 Details

Name: GLEAN_2437
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1111135..1116019 (+ strand)
Length: 4885
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1111135..1111961 (+ strand)
Length: 827
Type: CDS
Source: GLEAN
Position: GCSC_140:1112167..1112177 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_140:1112360..1112413 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_140:1112499..1112509 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_140:1112573..1114420 (+ strand)
Length: 1848
Type: CDS
Source: GLEAN
Position: GCSC_140:1114863..1114942 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_140:1115008..1116019 (+ strand)
Length: 1012
>GLEAN_2437 class=GenePrediction position=GCSC_140:1111135..1116019 (+ strand)
ATGGCTCCGTTTTACAAGAAGACGCTCATAGTCGGGGCGACGTCGGGCATTGGTGAGGCGCTGGTGCTTAAATTGGCGAG
CACGGGCACGGCGGTGATTGCGACGGGCCGACGACGAGACCGTCTGGACGCTCTCGTGGCCAAGGCGCCGGCGGGCAGCG
CGGCCATCACGACGATCGTGCAGGATGTTTGTGATTTCCAGGCGGCGCCAGCGTTTGCGGCGCACATTGCGGCGAAACAC
CCAGGTCTCGACAGCGTGGTGCTCAACAGCGGAATTCAGCGGGCGTTTGACTTTGGGCAGCCCGGCACGGTCGATCTGGC
GGCACTGGGAACAGAGCTGACGACCAACTATCTGGCTGTGGTGCACCTGGTGACGGCGCTCCTGCCACAGCTCCAGGCGC
AGGCACGGGCCCGAGACGAGGGGGCGGACCTCATCTTTATGAGCGCCACGCTCGGGCTAGTGCCGTCGCTCGTGCGTACA
CCCAACTACAACGCCAGCAAGGCGGCCCTGCACGCCTTCATCACAGCGCTGCGGCAGCAGCAGCTAGACGTCGGTCTTGA
GCGGCTGCGTGTCATCGAGGTGTACCCACCGGCAGTGCAGACGGAGCTGCACGACACGGTACACCAGCCGGACCTCGTTG
GCGGCGACAAGCTGGGCATGCCGCTGGACGCCTTCACAGACGAGCTGTACGCTAAGCTACAGACCCGCCCGACGGTGCAC
GTGGGCATTGGCCCTGTCGAGAGCCTTCTGGCCGAGGGCGGCCTCGAGGACCAGCGGCAGAAGCTGTTTGAGCAGCAGCA
GGTGCACGTCAAGAAAGCACTCGGCCAGTATATAAGAAAGTAGACGGGATGTATGCAGACATAGCGACGCAGGAAATGTA
AATGGGCTTCGAAGCAGCCCAACAAACAAAGATCGAAACGGCCAGGATCTGGAAATACGGAAGCCAAACTGGCTGACAAA
TAACGGAAGAGCCCCTGTACTCCATAGAGTAAAGAGGTTGCATAGAGTGCTCACGTGACCACGTGCTAGCAGTATTTTAC
CAGGTTTGTCGTCTTATCCCCAGCGCGTCTTCTCCCCACCAGCATATACAAACAGTGCCATCCGACAGTGGGCGTATGAA
AGATTTCATCAAAGACAGAAACCACGATAATCGGAATATGTATGACGATCTACTGCAGATTGCATCAAAACAATGGTGTC
TACTGACTCTGACTTCTCTTAATAGGGCCCGGCAACGTCAAGACCCGCAGGACCGACCTGCTCGACGGATCGTGGGACCG
TGAGTTTTCTGTGATCTGCAAGAAAGGGTTCTCCGAAATGATTCAGCTTGCTAAGACTCAAATGCAGGCAGTCGGCTTTG
ACAGATTACCTTGCGGTTCGTTATTGTAGAGTGGACTGTACAGGTTCGAATGCGATGCTAATTTTCCGGTTACTGCAGTC
CCACAACATCTCGGCTCGACAGATTGAGCACGATTTCCAAACGCGAAGAGAAGCAGCACTACGCCAAGCAGCTGAGGATG
CAGAGCGAGCACGCGAGAATGGGGAGTCCGTGGATGCAGGCTTTGGGACGCCAGCGGCGGCAGCAAGGAGACGGGCGTCT
GAGCGAATCGCAGCAGTGACGCCCTCAATATCCGAGACTCCCGAAACCCCTGGAAATGTCGAGTTACCTGAGGCAGAGGC
AGAGGTCACTGGAAGCGTTAGTGGCAGCGGGAAGAAGCTATCGGCGCAGCAATTAAAGGTGCTGGACAAGATCAAGCAGA
ACAAGAAGGGCAAGAAGAAGAAGCGGCGGGCACTGGACAGTGACGACGAAGACGACCAGACACTGGCGGCGCTGAGCAGC
ATGGCGGTGCCGCTCCCGGGACAGATGGAAAACTGCGGATCATGCGGCAAGCGGTTTACGGTGACGCCGTATTCGCGTGC
AGACCCATCCGGCCGACTGCTCTGCACGGCTTGCAGCAAGAAGCTAGATCAAGAGGACGAGGCAGCACGTGGAGCAAAGG
GTCCGAAGCGAGCACGAGGGTCAGGGCAAGGTGGAGCAGGCGGTCGCGGGGGTGTGGGAGGCGGAGGGCCGGTGGGCCAG
CGACGGAAGACACAGAGCCGAATCCTGGACGGGGCATCGCCGGTGGGAGTGAAAACATTACTAACGCTGTGCGTGGAGCA
CCTGTCACGCAACATAGACCGAGCTGAGGATCTGGGCGACCTGCCGGAGGACCTGGTGGACCGGGTCGGACGGATGTTGT
CGAAGCGGCGGCTGCTGAGCCCAATAACATTGCAGCTGCTGGTGCGACCAGAGTCCGAGGAGATTTGCGTGTACGATGGG
GCAGAACTGGTGACCAACGACTACCTGGCGATATTGCAGGCAATGCCGCGGCTACGACGGCTGGTGGTGTACAACGCGAT
TCAGTTCAAGGACGAGGCGCTGCAGTACCTACAGCAGCGGGACGTGCGGCTGGAAGCGCTGTGTCTGTACGGGGCGAACC
TGCTGTCGGAGACGGCGTGGAAGAGCTACTTGGTGGAGCGAGGGAAGTGGCTGCGAACGCTGCACGTGTGCTACACGGAC
AAACATGTGACGGACGATCTGGCGGCGTACGTGAGGGACTGCGCGCCGGAGCTGCAGCGGCTGAAGATCAAGGGAAACCA
GGCGATGGGGCCAGTGGGGGTGGGGCACCTAGGGGGGCTGGCGGGACTGCAGCACCTAGGGCTGGACCTGACAGCGTCGA
TACGAGCAGACGTGCTGGTGCGGCTGTTGGAGCAGGTGGGTGGCAGTCTACAGACGCTGTCGCTGCGACGGGCCGACGAG
GTGGACAACACGGTGCTAGCGGCGCTGCGGGAGCACTGCCGGGGACTGCGCAAGTTGCGACTGACGGAGAGCAACCGGTG
CACCGATGCAGGCTTTGTGCGGCTGTTCAACGGCTGGGCCAACGAACCGCTGCGCTTTGTGGACCTGGAGGGTTGTCGGT
TTGACGATCCGGACCAGCCGCGAACAAACGAGGCCGGCATCGGACTCTGCTCAGACGGTTTCCGGGCACTGATGGCGCAC
TCGGGCGTTGGGCTGCAGCACGTCAACGTGTGTGCGTGTCGGCACATTGGACGCGAAGCGTTTGAGGACGTCTTCGCGGC
TAGCAAGACGTACCCGGAGCTGCGCCACATAGAGGTCAGCTTCTGCGAGGGGGTCACGGACCAGATCGTCTGCAGCATGT
TCCGGTGCTGCCCGAATCTGCGAGAGGTGGTCACATTTGGTTGCATGCGGGTGACGGGCGTACAGGTGCCGCACGGACGA
GTCGTGGTGGGTGTGCCGAACGCGTTGGGGATGCAGACAGTAGGGCATGATGAGGAGGAGTAGGAGAAGAGATGGCGGAG
AGGAGGAAAGGAAAGGGAAAGGAGTAGGGCATATGGACAGGGAAGGGGAACAGGTGTTACGGACAATTTGAACTTTGCTA
AGATACCAGATGGGTGATGTCGTAAATGGCTACAAACAACTGCAGACGAAGGGCGTAGAAGACATTAATAGAGGGGCCAG
ACGAAGTACTACAGCGTTAGTTTTATAGGAAGTTAGCGGCTTTAGCGGCTTTCATTCCGTATCTCAAGATCGAAGTCGCG
ATTCGACAGCAGAAGAGCAAGCATTGCCGAGTGAGAAAGAGGATAAAGAAGACGTCCAGCATATTTTAATAGTTTAGCTG
TCTTTGGAGGCACCAGGTCATCCTCCCTTTCTCGCCATGGGATCACAGCTCTCGGACGACGTCCCGGTCAAGCCATGGAT
CGAGACGCCGTGTCTGTTCTCGGCCGCTCTCTCGCGTGCTGCCGGATGGTTGGTTTCTTTTGGGGGGTCTGACCTCTGCC
TTTTTCCTGTTACCCGCCTGCTGACAACGACAGTAACGTCTACCTCAAGCTCGAGTGTCTCCAACCATCGGGTTCGTTCA
AGTCGCGCGGTATCGGCAACCTGATGATGCGCGCGTCTGTCGGCGACAGGGACACCCACTTCTACTGCTCGTCCGGCGGC
AATGCTGGCCTGGCCTGTGCCGTGGCTGCGCGCGTCCTGGATGCGCCGGCGACCATTGTAGTGCCCACGTCAACGTCGGC
CTACATGGTAGACAAGCTGCGGGCGGCTGGCGCTGAGGTCCGGCAAAGGGGGGCCGACTGGGCCGCAGCAGACCAGCACT
TGCGCGAAGAGGTGATGCAGGAGGATGAGGAAGGAAAAAATGAAACCCAAAAGGTCTACGTCCCTCCCTTTGACCATCCC
GACGTCTGGGCTGGCGCGGCCACGATAGTCGACGAGCTGTCCGTACAGCTGCCGGTCGGCGTATGTCCGGACGCGCTCAT
CTGCAGCGTCGGTGGTGGCGGCCTGCTCTGTGGTCTGATGGAAGGCATCGAGCGGGTGTACGGGGCGCAAGCTCCCACAG
TCCTCGCTGTCGAGACCGCCGGCGCCGACAGTCTCGCAGCCAGCGTGGCGGCTGGCCGGCTGGTCACCCTACCAGCCATC
ACGTCGATCGCCACGTCGCTTGGTGCTAGACGGGTGGCTGAGCAGGCATTTGCATGGACGCAAAAGAAGCAAAAGAGGAC
CGTGCGAGACACCGTGAACGGCACTGTGCAAGATACCGACAGGGAGACAGCAGTCGTTCCTGTCGTCGTGACAGACGCCG
ACGCCGTCGAGGCCATCGTCCGGCTCCTTGACGACGAGCGGCTGCTGGTCGAGCCGGCCTGTGGCGCCGCGCTGGCGCCT
CTTTACGCCAAACATGGCTCCGGCGTCAGTCTGCTGCGCCACCACATCGGCGATGGCCTGACCGACGCCGCGTGGGCTGT
CCGCAACGTCGTCGTCGTCGTCTGCGGCGGCTCCAACATCAACCTATCCATGCTAGAGGAGTACCGGGCGCGGTTTGGCC
GGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62