GenePrediction:GLEAN_2439 Details

Name: GLEAN_2439
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1130422..1132037 (+ strand)
Length: 1616
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1130422..1130912 (+ strand)
Length: 491
Type: CDS
Source: GLEAN
Position: GCSC_140:1130980..1131373 (+ strand)
Length: 394
Type: CDS
Source: GLEAN
Position: GCSC_140:1131450..1131554 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_140:1131606..1132037 (+ strand)
Length: 432
>GLEAN_2439 class=GenePrediction position=GCSC_140:1130422..1132037 (+ strand)
ATGAGTTCTTCGCTTGAAATGACGACCAACGACCATGCAAACAGCCATGGCAGTACGGTGCCGCTTCTCATCGACGGCAA
AGATGTGCACACGGCCCAGAAGATGGCTGTTGTATCGTCTGAGCAGAAACGCACGGTGTGGAAGGCAGCAGCTGCTTCGA
ATGCCGACGCTCTTGCGGCGCTCGAGGCTGCCAGCCGAGCCTTCCCGGCATGGTCGGCGACAAAGCCGGCTGCTCGACGG
GATATTCTCATCAGAGCAGCAGACGTCTTTGACCGGCGGGCGGAAGAGCTGAAAGGGTACATGAAGGAGGAGACGAGCGC
CCATGCGGCATTTTCCGAATTCAACATCGCCACGTCGTCAGGCATTTTGCGCGATGTCGCTGGCCGGGTCAGCACTGCGC
TCTGTGGCAGCTATCCTGTTTGCGATGAGCCTGGGACGCAGGCGGTGGTGGTGAAGGAGCCGTATGGGGTTGTCCTCGGC
ATTGCACCCTGGTAGGGAGATTCCGTTTCCCATGTGATTCTGCCCCGGCGAGGTGGACTGTCTGACAGCGTACCACAGGA
ATGCTCCTTACATTTTGGGGATACGATCAGTGGTGTATGCGCTCGCAGCAGGGAACACGTGCATTCTCAAGGGCAGTGAG
TTTGCACCCCGTTGCTTCTGGGCCATTGGGTCTGTTTTTCGCGAAGCTGGCCTACCAGCTGGCTGTCTCAACGTGATCTT
CCACCGGCCAGAAGACGCTGCCTCCATTACGGCTCAGTTGATCGAGCATGACGCTGTCAAGAAGATTAACTTCACTGGCA
GCACTGCTGTGGGCAGGATCATCGCACAGACGGCAGGCCGAAATCTGAAGCCTACCCTGATGGAGCTGGGCGGCAAGAAC
AGCGCGATTGTGTGCGAGGATGCCGACTTGGACAGAGCGGCCCAACAATGCGCCCTGGGAACCTTTTTACATGTGAGTAA
CTGCTGGTGCTTGCAACGCCGCAAATGATTATACGTTGGCGGCAAGCTAATTTCGTTTTACCGCACAGGCTGGCCAGGTC
TGCATGTCGACAGAGAGGATTCTGGTGCATAAGAGCGTGCTGAAGCTATTTACGGGGAAGTTCAAAAAGGCCATTGAGAC
GATTTTTGATAGCGTAAGTTCAGGACAAGCTGTTGCTCAAGCCGTGGGCGCAAAGAAGATCTAGGGCCTGGTGCAGGATG
CACTGAGCAAAGGAGCAGAGCATGTTCATGGCACGATCCCCTCGCCAGAGGCGGGCGCCTTGGTAATCACGCCGACGGTG
CTGGGAGGCGTAACAAAGGAAATGGATGTGTACTACACCGAGAGCTTTGGCCCGTGTGTCAGTCTGATTGCTGTGGACAG
TGACGAGGAAGCGGTGGCGATAGCCAATGACTCCGACTACGGGCTGAGCGGAGCGGTCTTCACCAAGGACCTGAGCAAGG
GGCTGTCTATGGCTGGACGGATCGAGTCGGGGGCGGTGCACATCAACAGCATGACAATACACGACGAGGCTGGGCTGCCG
CATGGCGGAGTGAAGAGCAGCGGATGGGGGCGGTTCAATGCACAGGCGGGATTGGTTGAGTTTCTCAGGAGCAAGACGAT
CACATTTCAGATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62