GenePrediction:GLEAN_243 Details

Name: GLEAN_243
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:496006..500244 (+ strand)
Length: 4239
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:496006..500244 (+ strand)
Length: 4239
>GLEAN_243 class=GenePrediction position=GCSC_167:496006..500244 (+ strand)
ATGACGTCCGTGTTCTTCTCCCTGACGGGAGAGTCTTGCTTCACGCCATCAGAGGCGGAGAAGCTCAAGAAGCGCATCAA
TGCATCGGGCCCGACGCAGGTGTCATCGATCCGCGGGCACTGGGCGTACCACGTGAACCTGACGCCGTCGACGTCGCCCA
ACGACGTGATCGACGAGGTGGAGCAGCTGCTGCCGCTGGGGACCGGCTCAAAGGCAGCAGCAGGACCGACGGCCGCCGTC
GGACAGACGCGGACGTTTGCCATCGCACCGCGCAACATCTCGCCATGGAGCAGCAAGGCAACGAACATTGCGTTTGTGTG
CGGGCTGCAGGGGCGGGTAGAGCGGATCGAGCGCAGTCGCTCGGTGACGGTGGAATTTGCGGAGCCGCTGGAGAGCAGCA
GTAGCAGCAGCAGCAGCGACGAGATTCCTTTCCGGGACGTGATCTACGACCGGATGACAGAATCGATCCGGACAGGCGGC
GAGCCAGATTTGACAGCGATGTTTGCGACAGCAGAGCGACAGCCGCTAGAGGTGGTGGACATCTTTGGGACGGAGGGATC
GACACCACTGGAGGTACTGCAGGCGTACAACCGGCAGCGAGGATTGGCACTGGATGGCGACGAGATGGCGTATCTGGTGG
CCGAGTTCCAGCGGCTGGGACGCAACCCGCACGACGTGGAGTTGTTCAGCTTTGCGCAGGTCAACTCAGAACACTGCCGC
CACAAGCAGTTCAACGCGAGCTGGACGATCGACGGACAGCCACAGGCCAAGTCACTCTTCCAGATGATCCGCAACACGCA
CGAGCGCAACTCGTCGTATACGGTGTCGGCGTACAGCGACAACGCGGCCGTGTTTCGGTCGGAGTCGCCGCTGTTCTGGG
CGCCGGACTACTCGACCCGGGTCTGGCGGCTGCAGCGGGAGCTGGACCCGCCGTGCTTCCTGGCCAAGGTCGAGACGCAC
AACCACCCAACGGCCATCTCGGCCTTTGCGGGAGCAGCAACAGGGGCCGGCGGTGAGATCCGCGACGAAGGCGCCGTCGG
TCGCGGATCGACGCCCAAGGCCGGGCTGTGCGGATTTTGGGTGTCGGATCTGCTGATCCCGGACCTGCGGGCGCCGTGGG
AGACGGACATTGGCAAGCCGGGCCACTACACGAGCAGCCTGGACATTATGCTGGAGGCACCGATCGGATCGGCACGCTAC
AACAACGAGTTTGGGCGGCCGAGCATCACGGGCGTGTTCCGGACACTGCTCGCACGGGAGGAGGGCGAGACCGAAGCCGA
GGCTGCAGTAGAGGGCAACGGAGCAACAGACGAGTGGCGTGGCTACCACAAGCCGATCATGATTGCCGGCGGACTGGGCA
CGGTGCGGCCGCAGCACGCACTGAAGCGGGCACACGATGTGGCAGAGGGAGCTCACGTGATCGTGTTGGGCGGCCCGGCG
ATGCTGATTGGGCTGGGTGGCGGAGCTGCGTCGAGCAGTGCAGGCGGCGAGTCGACGGCAGAGCTAGATTTTGACAGCGT
GCAGCGAGGCAACCCGGAGGTGGAGCGGCGGGCACAGATGGTGATCAATACGTGCGTGGCGCTAGGAGACCAGAACCCAA
TCGCGATGATCCACGACGTGGGTGCGGGCGGACTGTCGAACGCGCTGCCGGAGCTGGTCAAAGACGCCGGCTACGGCGGC
CGGTTCGAGCTACGGCAGGTCGAGAGCGCGGACGGCAGCATGAGCCCGCTGCAGATCTGGTGCAACGAGGCACAGGAGCG
CTATGTGCTGCTGGTCAACGCGGAAGGCTACAATCGCTTTGTCAGCATCTGTCGGCGCGAGCGATGCGGCTTCTCGGACG
TGGGCACGACGGTAGCGGCAGCCGTGGGCGGCGGACACCCAGGTGAACCAGAACAGGCAGCGCGTTTGGTGGTGATGGAC
CGCGAGAGCGCCGAGCACCCGCGACCGATCGACCTGCCGATGACGACGCTCTTTCCCGAAGGCCGGCGGCTGGAGCGGGC
GGTGGAGTCACGCAAGGCGACGCTGGCACCATTTGCGCCTGCAGAGATCATCGCGGAGACATACGGCAAGGGCCTCACGG
CGCAGGAAGCACTCGCAGAGACGGTGCGTCGCGTACTGCTGGTGCCGTCGGTCGGGTCCAAGTCGTTCCTAATCACGATC
GGCGACCGATCGGTGGGTGGATTGGTGTCACGTGACCAGATGGTGGGTCCGTGGCAGACGCCCGTAGCCGACGTGGCCGT
GACGGCGGGCAGCTTCACGACCGAGGGCAGCAAGGCGCGGCCGGGCGAAGCGATGGCGATGGGCGAGAGGCCGACGCTGG
CACTGATCTCGCCAGCTGCGTCGGCGCGCATGGCGGTGGCCGAGAGCTTGACGAACCTGGGTGCAGCCGATCTCAAGGGC
GGACTGCGGCGCGTAAAGCTGTCGGCCAACTGGATGGCGGCAGTGAACCACGCGGGCGAAGGTGCGGCACTGTACGAAGC
GGTGCGGGCGATCGGCGAGGAGCTGTGTCCGAAGCTGGGGTTGGAGATTCCCGTCGGCAAGGACTCGACATCGATGAAGG
TGAGCTGGGGAGGGAAGAAGGAGGACTCGGAAACAAAGGGAAAGAAGACATCCGTGACGGCACCGGTGTCGGTTGTGATC
TCGGCCTTTTCGGTGGTGGGCGACACGATGCGCACATGGACGCCACAGCTGCGCCGGGTGGAAGAGGTGGGCGAGACGGT
GCTGCTGTTCGTGGACCTGGCCCGAGGCTACCAGGCGCTGGGCGGATCAGCACTGGCACAGGCGCTGGGACGAGTGGGCA
ACGAGGCGCCAGACGTGCGTGACAAGGCACGGGGTGACAACATGCTGGCCGACTACTTTGACGCGCTGTCGCAGCTGCAC
GAGAGCGGGGTGGTGCTGGCATACCACGACCGATCGGATGGCGGCTTGTTGACGACGCTGGCCGAGATGATGTTTGCCGG
ACGATGCGGCGTGGACGTGATGCTAGACGACATTGCGCAGTCAGGATCGCAGGCAGACGTGCTGGCGGCCCTGTTCAACG
AGGAGTTGGGTGCAGTGTTCCAAGTGCGCAAAGCGGACGTGAGCCTGTTCAAGAAGGGCTTCTCGACCTGCGGACCACCA
GCCGGGCTAATCCGCAAGTTTGGCGTGGTGACGCCAATGACCAACCGCGATGGCAGCACACGGTCACAGACGCTGACGAT
TCGCTACGGCAACGACACGCTGCTGCAGCTGCGACGATCCGAGCTGCAGGGCTGGTGGTCACAGACGTCGGCAGCGATGC
AGCGGTTGCGCGACGACCCGGGCTGTGCAGACGCAGAGCTGGCGACGATCGACGACGACAGCGACCCAGGCTTGGCATAC
CGGCTGACATACACGGTGACAGACGGGCTGGCACCACTGACGGCACCACTGTCACGGCTGTTGGGCCGGGCGCCTCGGGT
GGCTATTCTGCGGGAGCAGGGCGTCAACGGACACGCAGAGATGGCGTTTGCGTTCCGAGCAGCCGGCTTCGACCCGGTCG
ACGTGCACATGACGGACGTGTTGGAGGGCCGCGACCTGGCCGATTTTGCCGGGCTGGCAGCCTGTGGCGGTTTCTCGTAC
GGCGACGTGCCAGCGGCCGGCATGGGCTGGGCGGCGTCGGTGCTGCTGCACGCGGGAGCGCGCCGCGTGTTTGCCGACTT
CTTTGCACGCCCAGACACGTTTGCGCTCGGCGTCTGCAACGGCTGTCAGATGCTGGCGCGGCTGCAGAGTCTCATCCCGG
GCGCCGACCACTGGCCGACGTTTGTGGACAACATTAGTCAGCAATTCGAAGCCCGCCTCACGATGGTGCGCATCGAGGCC
GACGACGCCAGCCGGATCGACGGCGTGCCCCCGTCCATCTTTCTGCATGGCATGGCCGGCTCTGCGCTGCCGGTGGTGGT
GTCCCACGGCGAGGGCCGCGCGCTCTTCGCCTCGCCCGCTGACCGCGACGCTGTCGACCAGGGCGGCCTCGCCCCCGTGC
GCTACGTCGACAACCGCCTCCGCGTCACCGAAGCCTACCCCGCCAACCCCAACGGCAGCCCAGCGGGCATCGCCGCCGTG
CGCAGCCGCGACGGCCGCGTGCTCGCCATGATGCCCCATCCTGAACGCACCATCGTTGCCGGCGTCGGCTCCTACCTGCC
GCCGGACGCGATCGAGCAGTGGGGCGACTACGGACCGTGGATTCGCATGTTCCGCAGCGCGCGGCGGTGGGTGGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62