GenePrediction:GLEAN_2440 Details

Name: GLEAN_2440
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1135126..1136683 (+ strand)
Length: 1558
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1135126..1135587 (+ strand)
Length: 462
Type: CDS
Source: GLEAN
Position: GCSC_140:1135643..1135766 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_140:1135826..1135947 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_140:1136006..1136683 (+ strand)
Length: 678
>GLEAN_2440 class=GenePrediction position=GCSC_140:1135126..1136683 (+ strand)
ATGACATTGACACAGGCCGAAGCAAAGACAAAGCTGCCAGCCAGCTTCCCTATTATATGGAAAGGGGACACTGGCTACGA
GAAGGCTCGGATTGGCCGCGTGTTCAATTACCGTCGCCCAGACCGATTCCCAGTCGCGGTGGTAGAGGCCACGGCCGAGA
GCCATATTGTCGAAACGGTGCGTCTGGCTGCCAAGATGGGCTATCGTGTTTCTGCTCGTTCTGGAGGCCACAGCTGGGCC
GTCTGGAGCGTGCGTGACGAAGCCATTCTGATAGATCTGGGCCGCTACCACGAGTTCTCCTTTGACACGAACACGGGCAT
CGCCACGGCCTCTCCCAGCACGACTGGTCGCCTGATCAACAAGCTGCTGGAGCCATACGGGCGCATCTTCCCCGGTGGAC
ACTGCCCCGAGGTGGCCCTGGGCGGCTTTCTCTTGCAGGGAGGCATGGGATGGAACTGCAAGGTAGATGCCAGCCCCGAT
AGCTCTGTCTGCGAAGCACAGCTAACGACAGAACCAGAACTGGGGCTGGGCCTGCGAACGAGTCTTGGCTGTGGACATCA
TCACTGCTGACGGCGAGCGGCTACACTGCAACAGGAGCCAGAACATTGACCTCTACTGGGCAGCACGTGGTGCCGGGCCA
GGTAAGATTGCCTCAGTGGTGGCTCCATCGGCTGATTTGTATCTTACGTTCTTCCACCAGGATTCCCCGCCATCGTGACG
CGGTTCCATCTGCAGACGCTCCCCGCATTCACCCATATGCGCTCTTCTGCATACATTTACAAGAAGGAGGACTACCGTAG
GGTCTTTTCGTGGATTCTCAGCGTAAGATGCATTTCACGTCACGTGACTGTTGCATGCAACTGACGACGACTCTGACCAG
CTTGCGCCGACGTACGACGTGGACACGGAGATTGTCATGGTCGGGAAATACACTCCGGGACAAACAGAGGTGAATATGAT
GGTGCTGCTTTTGGCGTTCAAGAACAGCGAGGCGGAAGCAAGAGCGGCGCTGCAGACGGCCGAGGTTTCGGCGCCAGCCG
GGCCTACAGACCGGTGGTTCTGCAAGGCGACGTCGCTGGCGCAGGAGTACGACGACCAGCAGGCGGCCAATCCAATGGGA
CACCGATACTGTGTGGACAACTGCTACGTAGCTGACGGGGCGGACGTGGTATCGGTGCTGGAAGACGCCTTCACGAAGCT
GCCATCACGCCGCTCCTTTTCACTGTGGTATTCGATGGCGCCGGGCTCGCAACGGGACGCCGGCTCGATGGACGACATGG
CCCTGTCCATGCAGACGGACCACTACTTTGCCACGTACACGATCTGGGAGGACGCGGCCGACGACGAGCTGAACTGCCGC
TGGGTCAACGACACGCTGCAGGCCATCGGGCGTCATGCTGTCGGCAGCTACCTGGGCGATGCCGACTTCCAGGTGCGCCA
GACACAGTTCTGGGAGGCCCAAAAGGGCCATCGGCTGATGCAGATTCGCCGCGACCGTGACCGGTTCGGCCGCAGCGGCA
CCAAGGGGCTGGCCAACGTGCACGAGTGGAAGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62