GenePrediction:GLEAN_2441 Details

Name: GLEAN_2441
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1138138..1141437 (+ strand)
Length: 3300
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1138138..1138701 (+ strand)
Length: 564
Type: CDS
Source: GLEAN
Position: GCSC_140:1138792..1139047 (+ strand)
Length: 256
Type: CDS
Source: GLEAN
Position: GCSC_140:1139104..1139493 (+ strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_140:1139547..1140442 (+ strand)
Length: 896
Type: CDS
Source: GLEAN
Position: GCSC_140:1140895..1141437 (+ strand)
Length: 543
>GLEAN_2441 class=GenePrediction position=GCSC_140:1138138..1141437 (+ strand)
ATGGCGACTACGGATTCAGGCGATGCTGCGAACGGCCTCGTCATTGGGCACGCCAATGGACATACCAATGGCCACAGCAA
TGGCCAGGCGACGCCCCAAGGCCTGAGCATCATCATTGTCGGTGCTGGCATCGGCGGCCTGATGGCGGCAATCTGCCTGC
GGCAGGAGGGCCACCGGGTGACGCTGCTGGAGCAGTCGCGGTTTGCCAACGAGGTCGGAGCAGCAGTGCACATGGCGCCC
AACGCAAACGGACTGCTGCGTCGCGTCGGTATCTTTGTCGAGAAGTTTGGGGCCAACAAGATGGAGAGAATGACCGAATA
TGACGAGAAGAGCACGTCGAAGCGCGAGATTGAGCTGGGCGAGGCGAACAAGCTCTGGCAGCACCCCTGGCACCTGGTGC
ACCGCATCCATCTGCACGAGGAACTCAAGCGGCGGGCCACATCGCCGGACGAGGCTGGCACGCCCACACCGGTGCTGCGG
ACACGCAGTCGCGTGGCCGACGTCGATACGGCAGCAGGTGTCGTCGTGCTCGAGAGCGGCGAGCGGCTGGAAGCAGATGT
GATTGTGGGAGCTGACGGGGTGCATGTGAGTTTTTTTTTTTTTTTTTTTTTTGCCTTTCCTCTCCTCTCAGTTCTATCCC
TCCTAACAAAATAGTCTGTCACCAGAGCCAAGATCCCCGGCGGAGACATCAAGACGAAACCATCGGGCAAGAGCGCCTTC
CGCTTCCTCGTCTCGCGCGAGGCTGCCCAGGCCAATGCGAAGACGGCCAAGTTTGCGAGCAAGAACGGCGAGCTGATCAT
GTGGTTCGGCGCCGACCGTCGCGTCATCATGTATCCGTGCGACGACAACCGACAGCTCAACTTTGTGTGCGTGCATCCAC
GCGAGGAGACCCAGGTGGACAACGTGGCCGGTAAGTCTGTCCCAATACCGCCAGCAAAAACTGTGCAATTTCGATCTGAC
AGCCAGACTGGAACACGGGCGGAAACAAGGCCAAGCTGCAGGAGGTCTACCGGGGCTTCGACTCTGACCTGCTGGCACTG
CTAGACCTGGCTGAGGCCGGCTCGCTCAAGGTGTGGGAGCTCCTGGACATGGACGTCCTTCCGTCCTGGACAAACGGACG
GCTGGCCCTTCTGGGCGATGCCGCCCACCCATTTCTGCCACACCAGGGCCAGGGAGCCGGCTGTGCCATCGAGGACGCCA
CCGCTCTGGCGGCCGTTCTGCACAAGGGCGTCCAGGCTGCAGACGTGGCCGAGCGGCTGCAGCTCTACCAGGATATCCGC
TATGTGCGCGCGAACAAGATCCAAGAGTTTTCACGCAAAGCCGGCCGCGATCTGGATGATCGAGCCGGGCTGGACAGTGA
GTTTAAACGCCCGAAGACGGCCCATTTGCCCAGCTGCTGACACGTCCAGTGATGGAGTACACAAACTACAACTTTGGACA
CGACGAGTGGGACAACGCAGTGGACGTGGTGCGCAAGTGGGAGTGGAAGCGCAAGCCGCATCTCTACTGGCGCATGCCGG
TCTCATTTGGACCGTTTCCGGGCCCACGGCAGACATTCGAGGGCCTGCCGCGGACGGCGACGCAGTCGACCTTTGTCACG
GCATCGGTCAAGTTCAAGACGTCACGCACGATGCTGCAGAACCTCTTCCCGTCCGTCTCGTTCCGTTTCAAGAGCCCAGG
CACCGTGGCCCATGCGAGCTTCTCACAGACAACCCTAAACGGCATGGAGTGGCTCGGCGGCGGCGGCTACCGCCACCTGG
GCCTGTACATTCACGGCGTCGAGTACGTGACTAAGAGCGGTGCCGTGCTGGACGGCACTTTCCTGCCGCTCCTGTTCGAG
AACTTGACGGACCCGATTGTGAGCGGCCGCGAGGAGCTCGGCATGCCCAAGCTGTACTGTTCCATCGACGTCTGGCGTCG
CGCAGCCAGCTACCGCATCCAGGCCGGCTGGGAGGGTGCTTCCTTTGGCTCCATCGTTCTCAAAGACCTCGTCGAGGCTG
ATCCGGCTTCCACCAAGGGCACCATTGGCGGCGAGGATGACCAGGGCCTCTTTGCGTACAAATACATCCCGCGGGTCGGT
GAGCGTGGCTGCGCCGACGTCGAGCACGCCACCTTTGTACCCCATGCTGAGGAGGCCCGCGTTGTGTCTAGCCGCGTCGT
GCGCATGTTCGAGACTTCCAAGGCCAGCGTGTCCTTTGAAGCACTCGACTGGGAGAGCCTGCCGACGCTGCACCACGTCG
TCTCCCGTCTGGCCGAAATCCCCATCTACGAGGTCATTGGGGCCAAGGTGGTCGAGGGCCTCGGGGTCCCGGACGTCTCG
AGCGCGAGGCGCATTGACTGAGAGGGGCAAGGGGGGGGAATAGAGGAGCAGAGAGGAGCAAGGAGGAGCAGGGAGGAGCA
GGGAGGAGCGGTGTATGGTAGCAGTGCTGGCAGACAGCAGGTAGTTTGTGTAAATACGACATGACTGGCAAAACCTGAAT
TTCATAATCTGAATGCTCTCTGCCTTGTAGCCACTACCCGAGGGAGGCCCGAGCCGGGGTTCTCGGAAAAGTCCCCCACA
TCGGAAGATGTTTTCCTACTTAAGTTGTATTAGATGTATTTATTTTCGAATTAATTTAATTCGCTTAGACGTTATATCTG
TACCAAGCTGCAGATCTGGCTAGCAGTCGGAGATGCCACCATCTTCGCCTTGCCGTCCTCGTCATACCGCCTCGTATTCC
TACGTCTCATCTACGACTCAGATCTAACATGTCCAAGCCAATCCCACCCAAGGATATCCGCCCCATCCGGCGGTTTATCA
CAACACACGCGGCCGACGGGACGACGGGCTTCTCTGACGCCGTGCCCGAGGAGGCGCCGTTCAAGACGCTGCTCGACGGC
GTGCAGTTTGCGCTCTGCTATGCGTCCAACACGTTCCCGGCCCAGCTGAGCGACGATGCCGACCTGGACGTGTACAAGAA
CTACATGACCAATCTGCCCGGCATCAACATCGACACCGGCTCCGTGCTGCGCGTTGTCGACATGCAGCCGGGCATGCTGG
CACCCATGCACCGCACTGTCAGCCTCGACTACGGCGTCGTGCTTGAGGGCGAGGTCGAGCTGATGCTGGACTCGGGTGCG
AAGCGACTGATGCGACGCGGCGACATATCCATCCAGCGCGGGACTAACCACACGTGGCGCAACACGAGCGAGACGAGCTG
GGCCCGCATGCTGTACGTGCTGTTGCCAGCACAGCCGCTGCTGTTCAACGGTCGGGCCCTGGAGGACAACACGGAGGAAA
CCATTCCGGGACACAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62