GenePrediction:GLEAN_2442 Details

Name: GLEAN_2442
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1141798..1144714 (+ strand)
Length: 2917
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1141798..1141918 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_140:1141989..1142043 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_140:1142098..1142746 (+ strand)
Length: 649
Type: CDS
Source: GLEAN
Position: GCSC_140:1142822..1144714 (+ strand)
Length: 1893
>GLEAN_2442 class=GenePrediction position=GCSC_140:1141798..1144714 (+ strand)
ATGGCAGACCGCTCCATGGAAAAGGAAAAGGGAAAGCCGGCCAGCCACAATCTGTTTCAGTGCTCGGCCTGCAAGCGGAC
ATACACTCGAGTCGACCACCTGGCCCGACATGTCCGGTCCCGTACGTCGTCTGTCTCTGTCCGACTGAGCAGGGTGAGCG
GCAATGCGTGCTAATGCTATTGATCCTGCAGATCTCCACGAGCGGCCATTTCAGTGCCCGACCTGCAACAAGGCCTTTGG
CAGACTGTCCGTAGCCGCCACTCTTCCTTCTACGGCGACACCGTGCTGACGACCAGACAGAGACCTGCTGAAGCGACATG
AGACCTGCCACCAAGACGACCGGAATAGTGGACGGACACGTCGAAGTCATGCCGGCAGCCAGAGCTCGCGGGTGTCGCAG
GCCTGTCGCGAGTGTGCGGCGACGAAGCTCAAGTGCGACGACGTCAAACCATGCGGACGGTGTCGGCAGCGCGGCCTCAC
ATGCGAGTACGTCTCGGATGGCCGGGAGCACCTCAAGATGCTTGCTTCGGAAAGTCCGGTTCCGGTTGCAGAAACGAGCC
CACAAAGATGTGATCCTGCAGCAGCCACGACGACGGCAGAGACCGATAAGATCCCGCTCGATCCCTCCCTGCAGGACCAG
CAGCCGCCCGGCGGCTTCCCCGACCACGACATGACTGACTTTCTTCGGGATGTCATGACACCCAACCTGCCGTCGCTGTC
TACGAAGGCCTGGCTGGATGCCGATGCTATTGGGCCCCGTGGCCTGCTGGACTTTACGAGCGATGGGCTCGAACTGGACG
ACAGCGACTTTGGCTTTCTGGACGACTCGTGCGGCGGTGAGCCGTTCAGCATGGCTGCGGCGACGGCCATGGCCATGGTC
CTGGATCCGTCGATGGAGTCGCAGCATTCCTTCCCGCCGGCCATGCTCACACAGCTCGAGACGGCCGTGGTGGCAGCGAC
TTCGGCAGCAGCAGCAGCAGCAGCGACAGCGACAGCAACAGCACTGCCGGCCGCACCGACAGAGCCGATGACCGGCAGAG
GACGAAACGTCGGTCTGGGCACGGAGGCCTTTAAGCGGTCGACATTGGGGATGTGGCTGCCGGCACTGCACGAGGGCTCG
GAGGCGGAATTGGAGCACCTGTCGGTGCTGAGTGCAGAAGCGGGATCGTCACCGGACACGACACGGTTCAACGTGGGTGC
TGAGCATCGGAGCATGCACGGGGGGGTAGGACGGGCGGCACGGGACGGCGTGCTGGCGATGGTGCTGCGAACCTGTCGGC
CAGAGCGGGCGCTGACGGTGGTGCAGACGTTTCCGCCAGCCGAGCTACTAGACGACCTGCTGGCCTGTTTCTTTGCGCAC
CACCGACAGCACGCCGACAGCTTTCTGCACGTGCCGACGTTTGACGTCAACACGCAGCAGCCAGAGCTGATCGGAGCACT
GTCGGCCTTTGGGGCCACGCTGACAGACGCGCGGCCGCTGCACCGACTCGGCTTCGCCATCCAGGAGGCGGTGCGCAGGA
CGGTGCCGGGCCGATGCGAGGCGGCCAACGCGACGACACGCGAGCTCTGGCTGCTGCAGGCCTTTATCTGCGAGCTGCAG
GTCGGCATGTGGAGCGGCATCAAGCGCAAGATGGAGCTGGCCGAGAGCCACGCGCCGGTGCTGTACACGATGCTGCGGCG
AGCTGGCCGCTTCCACCGGCTGCAGCGGCCAGCCTTTGAGGGTCCATTGGCCACGGACAGTGGCGCGGTGCTGCAGCGCA
AGTGGCGAGCCTGGGTCGAGCAGGAGAGCCTGCGCCGTCTGGCCCTGCACGCGGCCATCTTTGACGCGCAGGTGTCCATG
GCCCGGCTGACAAACCCGATCATCTCGTACGCCGAGCTGGCCATTGCACTGCCGGCATCGCTGGCCCTCTGGCAGGCCGA
GGATGCGGAGCAGTGGAGGGATCAGTACTTGCGAGAGGTGGGGGAAGGCGAGCTGGGAGGACCAGGAGGAAGAGCAGGAA
TGGAGCCAGAAGGAGACGTCGATGCCCATCCGTCGTCGCTGCTCGACTTTCTGCAGCATCAGCCGGCCGAGCTGCCGGCC
CACTGCGACAGCCGGTTTTCCAGCCTGGTGCTGCTATATGGCGTCTGGGGCCTGGTGTGGCAGCACCTGCAGCAGGCGGC
CACGCTGCGACACTGGTCGGCCTCGAGTGGTGGTGGCAGTGGCGGCGGGCAGCCAGGGGCTCTAGCCAGTCTACGCCATC
AGGAGCTGCTGCAGACGCTGCACCACGTGCGGCTCAGCATCGGCGAGGTGGCGCGCTCGTCCGAGGCCGGCCTAGTGCTC
GAGCTGCTGCACATGTACCTGCATATCAACCTGGGCGACATGCAGCTCTTTGCCGGCAAGGAGGACGTCGAGGATGCCCG
TCGCGTGCTGCCGTCGCTGCAGCGCTGGTGGGCCGAAGGATCCGGTGCCCGCCAGGCTGTCTTCTACGCCGGCCAGGTCC
TGCGCGTGGCCAAAGCCTTTCCGGCCCGCCGTCTCTGTCGCTTCTACGCTATCGCTGTCTACCACGCCGGGCTCGTCCTC
TGGGTCTACGGCGTCATCTGGCTGTCACAGCAGCAGCAGCCGAATGGAGGGACCGGCCAGCAACAAGCACAACCATCCTT
GATGGCCGTCCAGCTCGATGGTCCCGAGTCGGCCACCATCCAACGCTTCATCGCCATGGGCAAGGGCACCCCCTGTGTCG
GCTTCCATTTTGGCGGAAACCCGACGGCCGGCGTGGTGGCGCTGTCAGATCCCGAGGCAGTCATGGATGTCGTCGTCGAC
ACGCTGCTCGGAAACTTCCCCACGACCGTCAGGACCCAGGAACCACCGCCGATTGTGCAGAATCTAGTACAGCTCTTGCG
CGGTCTTGGAAAAGCAGCCGGAGAGATGGCAGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62