GenePrediction:GLEAN_2443 Details

Name: GLEAN_2443
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1145684..1147259 (+ strand)
Length: 1576
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1145684..1146100 (+ strand)
Length: 417
Type: CDS
Source: GLEAN
Position: GCSC_140:1146157..1146886 (+ strand)
Length: 730
Type: CDS
Source: GLEAN
Position: GCSC_140:1146946..1147259 (+ strand)
Length: 314
>GLEAN_2443 class=GenePrediction position=GCSC_140:1145684..1147259 (+ strand)
ATGTCTATTCCCGCGAGCTTACCTTTTCCTCGGTTGCAGGACGCCCTGATCGAGGGCCGTCTGGCCAACGTGTTCTACCG
TCGCGACCAGCTGCGGCATCTGCAGGAGGGACTGGTGCGGCAAAAGGATGCGCTTCAGGCGGCCACGGTGCAGGACGGCA
GCAGTACGGTGCCCGAAGCACTGGCTGAGCTGTACCTGACCCTCACGGCCGTCAAGCAATACCACGACGGGCTCAAGCCG
GCCGGGCCAGACGGGCTGATTGCAGCCGAATACCGCATTACCCATGGACGAGATGCGGCCGATGCGCAGGAGCGCGTTGG
GATTGCCGTAATCGTGCCCCAGAGACACACGCTGGTATACTCGGTGGTCGTCCCGCTGGCGGCGGCCATTGCGGCCGGGA
ACTGTGCTGTGGTCGTGGTGAGTTGCCGTCCGGAAACAGAACCCAAATAGCACATGCATACTGACACCCACAGCTAGAGA
AGACGCTACAGAGCCTTCCGCCGCTGCTGTCGGGTCTGCTGGGCGAATGCATCGACCGCGACATCTGGGAGCTCGTCTCG
AGCCGACCGGCCGGCCTGGATGCCTCCGACTGCTGCATCCAGGTCGTGCAGACGGGCGACGACGCCGACAAGGACACGAG
CACGCCCCGGACACTTCTCTCACCGGTTCGGGCGCTCGTCGTGGCCATTGTCGACCGCACGGCCAACCTAGAGCAGGCGG
CCCAGCAGCTGGTCGATGCGCGGCTCCGATTTGGCGGCCGGTCGCCGTACGCGCCGGACATCGTGCTGGTCAACGAGTTT
GCCAAGCAGGACTTTCTGCGGGCGGCTGTGCAGCACTGGATCCGATACACGACCGACGGAGGACCGCTGGAGAAGAAACC
GGAAAACGGTGCGACAGCCGGCAAGACAGTCCCGAGCCAGAACGGCGTCCGGACAGTCACGGCTGGGTCCGACAGCCGGA
TCGAGGACGTGCTCGACCGGTCCACGCTGTTGCAGGCGCCGGAGCGGAACAAGGTCTGCGAAAGAGCCCTGCGCGTGCAT
GCAGTCCGCAGCTTGGACGACGCGGTCGAGCTCATCACCGACATGACGCCAACTTCGCCGCTGGCCGTCTACGCGTTTGG
CGACCTGCCGAGCTGCAAGTACCTGCTGCAGTTCACATCAGCACATGCCGGCTTTGCCAACACGATTCCGCCCGAGCTTC
TCGGTACGTTCTGTGTTTCTCTGTTTCTTCTACTGCGCATGCTTCCCGCTGACAGCTACTAGTTGGGCCTGCTGCCCCTA
AAGACTACGCGCTCTCGCTTACCGCCCGATATGATCCCGGCCTCTTCTCGGTTCCGCGGCCCAAGTTTGCAGAAACCTCT
GCGCTCTCGCGCGAGATGGCCGCCATCCTCGACAGCCGGCCAGCGGCCGTGGAGGCGAAACTGCTGCGGAAGGTGGAGCT
TGAGGCGAGGGCACCCGTCCGCCTGATTACCGGGTACTTTGAAATGTCCGCCCTGGTCGGCCTGATTACGCGGGTAGCTT
TTGTTGGCGCGTTGACGTGTTACGGTGTGCAAAAGGTGGTCAGTCTGCGGAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62