GenePrediction:GLEAN_2444 Details

Name: GLEAN_2444
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1147504..1148425 (+ strand)
Length: 922
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1147504..1147638 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_140:1147691..1148425 (+ strand)
Length: 735
>GLEAN_2444 class=GenePrediction position=GCSC_140:1147504..1148425 (+ strand)
ATGCCGCTCACGCCTGTCCACTTTTTTTCCCATGGATCGACCATGATGATGGGTGAAGAGTCGCGCTCCGCCGATTACTG
GAAGAAGTGCGGCGACGAAGCCCTGGCCCACGGTATCAAGGGCGTCGTGATCATGGTGCGTTGTTCCTATGCTCTTCGCG
GTCACGTGACCATGCTGACACATCAAGGGTGCGCACTGGGCGACCAAGGCCGACACGATCGAGGTGGCGAGCAACCTGAC
GCCGACCAAGTCGCCGGTAGCGTACGTGCACCCGTCCAAGTACGTGGACTACGCGCTGAACCCAGACGCGGCGACGGCAG
AGCGGTGCGTGTCGCTGCTGCGCGATGCCGGCTTCCCGGCCTCGACCAATTCGTCGTTTGACTGGATCCACGACACGTAC
ATGATTCTGCTCCGCATGTTTCCCAAGGGCTGTCCGCCGACGACGATCGTGTCGATGAACCCGCGCTACGATCCCAACTA
CCATGTGCACGTGGGCCTGGCGCTGCGGCCGTTGCGCAACGAGGGCTACCTGCTGATCGGCTCCGGCGGCGCCGTGCACA
ACCTCTTCCGCAACGTCTGGACCCCAATGATCGTCCACGGCGACAACTTTGCCCAGCCGACGCCGCCGGCCCCTTGGGCG
CTCGAGTTCCGCCAGAGCGTCGAGGACGTGGTCCGGCGCGGCGGTGGCCCCCGTCTGCGCCGTGCCGTGCCGCGCCTCAT
GAAGCACCCCCTCTTCCGTGATGCGCATGGCACCGACGATCACTTCATGCCGCTCTGCTTCGCCGCCGGTGCCGCCGGCA
CGCCCGACGACGAGGGCGCCGTCGGCTCGCTGGGCGCTGAGGACTGGGAGCTGACCAACATGTGCAACAGCCAGTTCACG
ATCGGCTCTTGGCAAGGACACGCGCTCGTCAAGGCACAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62