GenePrediction:GLEAN_2445 Details

Name: GLEAN_2445
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1149009..1150103 (+ strand)
Length: 1095
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1149009..1149542 (+ strand)
Length: 534
Type: CDS
Source: GLEAN
Position: GCSC_140:1149603..1150103 (+ strand)
Length: 501
>GLEAN_2445 class=GenePrediction position=GCSC_140:1149009..1150103 (+ strand)
ATGGCTCCCTCGCGCATCCCTGCCATCTGCCTGGGCCTAGGCCTGGCCATCTGCCTGGTCTGGTTCACCGTCCAGCTGAG
CCTGCGAAGTCCGCACAACCTGCTCGCCCAGGCCACGGATTTGTTGGGCGGACTGCACGACCAAACGTCTGCGCTGGACG
AGACGATGTCCAACGGAACCGATCGGCCGCTGGTGCTATATGCCTATGCCGAGTCTAATGCCGGTCGTGCCGATCTGGCC
TTTTTTGTGCACAACGGTCTGCACCGGCGCGCCGACTTTGTCTTCATCTTTAACGGGCCGACCAATGCGACCGATATGGT
CCCGGCCGACCTGCCCAACGTGCGTGTCGTGCAGCGCAAAAACACCTGCTTCGACCTGGGCGCCTTTGGCGAGGTGCTGC
GCACAGATGACCTCTGGAAGCGTTACAAGCGCTTCATCACCATGAACGCCAGTATTCGCGGCCCTTTCGTGCCGCTCTAC
TCATCCGCCTGCTGGACAGATATCTTTCTTAACCGGGTCACCGAGCGTACTAAAGTACGTGTTTCCTAGTCAAGCTTTCT
TCCAACAGCTCTTTCGTCTTTCTAACTGTTGCAGCTTGTCGGCCTCTCTCTCAACTGTGGCCCACGACCGCACGTGCAAT
CGATGATCTGGGCTACAGACTCCGTCGGCATGGCAATCTTGCTCGACCCCGAACTGGCACACTCGGTCGGCCGTACTGAT
AGTTTTGCCAATAGAAAGAGCCCCGTCGGCCTCACCCCCTGCTACAGTGACTGGCGAGCAGCCGTACACGCCGAGATCGG
CACCACGGAGCTCATCCAGTCGCAGGGCTACGATGTGGACGTGCTTATGACAGCATACCAAGGGCATGGTGGAAAGCATG
GAAAGCATGGAAGGAAGGCGACCAAGGCGTATTGCGACACTCTGGACGAGATTGCAGACCCCTTCACATTACAAGGCTAC
TTTGGCAGCAACATTCACCCCTACGAGACAGTGTTCGCAAAGGCGAACCGGGACATCGACCTCCCACTGCTGGAGCACTT
GACATTATGGCACATGAACATGAATCACACTGCCTGGAACATGTGCGGGTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62