GenePrediction:GLEAN_2446 Details

Name: GLEAN_2446
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1156270..1158248 (+ strand)
Length: 1979
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1156270..1156578 (+ strand)
Length: 309
Type: CDS
Source: GLEAN
Position: GCSC_140:1156652..1156745 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_140:1156804..1157543 (+ strand)
Length: 740
Type: CDS
Source: GLEAN
Position: GCSC_140:1157607..1157802 (+ strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_140:1157857..1157933 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_140:1157985..1158248 (+ strand)
Length: 264
>GLEAN_2446 class=GenePrediction position=GCSC_140:1156270..1158248 (+ strand)
ATGTCCGACAACGAGAAGTCCCCTGGCGCTGCCACCACCGCCATCTGGTCATCCCCTTTCAAGGCGGCCTCAGAATCTGC
AAACGAGTCTTCTGGCGACCTCGACATTGGCCTCGGCCACGATGCCCTCGACGAGAATGCCGTCAACACGAACCCATTTT
CCGACCCGACCGTTGCAGAATACTGGCGCGCAACCTACGAGCAAAGCAGCTACGAGTGTCGTCACGTCTTTGATCCCCTC
GCCACTTGGACCCCCGAGGAGGAGCGCCGGCTTATTCGGAAGCTCGACTGGCATGTCTGCCTGTGGGCGGTATGTCCAAG
TCTATTCGGCTGTCCAGCTGCACCTTTTCGGCGAGTGTCTGCATGGCTGACTCACATCGTAGTGCGTCATGTTCTTTGGT
CTGCAGGTCGACCGCGGAAATCTCTCGCAAGCCCTCTCAGACAATTTTCTCAAGGATCTGCATCTGACGACAAACGGTTA
GTTTCCGGATCCATCTGTTCCTGGTGACACCTTCTAACCCCCCTCCCCCCCCAGACTACAACTACGGAAATACCGTATTC
CTTCTGTCCTTCCTGGTCGCCGAGCTGCCGTCCCAGCTTCTCTCCAAGAAAATCGGCCCTGACCGCTGGATTCCGACCCA
GGTTGTCCTCTGGTCCGTCGTGGCCACGTCACAATGCGCCATCACCGGTCGTGCCAGCTTCCTGGCCACGCGCTGCTTGC
TCGGCCTTCTCGAGGGCGGCTTCATCCCCGACATAGTCCTCTGGCTGTCGTACTTTTACACCGGCCGCGAGCTGCCCGTA
CGGCTAAGCTACTTTTGGACTTCCATGTCCGTCACCACCATTGTCACCTCACTGCTGGCCTTTGCCCTGCTGCACCTGCG
CGGCGTCCACGGCTGGGCCGGCTGGCGCTACCTCTTCCTGGTCGAGGGCCTCATCACCCTCTCCATCGGTCTGGCATCCT
TCTTCCTCATGCCCGCTTCGGCCGTCCAGACGAAGACGTGGTTCCGCCCTCGCGGTTGGTTCACCGACGGCGAGATCACC
ATCGTCGTCAACCGCGTCCTGCGCGACGACCCCTCCAAAGGCGACATGCACAACCGCCAGGCCGTCACGCCGCGCCGCCT
TTGGGAGGCCATGAAGGACTACGACATGTGGCCGCTCTACGCCATCGGCCTCGTCGCCTACATCCCTCAGACCCCGCCTT
CCACCTACCAGTCGCTCATTCTCAAGGCCCTCGGCTTCAGCAGCTTCAACATTAACCTGCTGGCCATTCCCGCTGTATGT
TTTGCCGTCCTCCTGTCCCTTTGTACAGCCTCTTCTTGTATCTTGCTAATCTTACAGAACGTCTTCCACATCATCAACCT
TATTATCATTACCCGACTCGCCGACTACTTTAAAGAGCGAACCTTTGTGTCCATGATCCAGTGTATCTGGACTCTTCCTT
GCGTTATCGCCTTCCGCTGGTGGCCGGGCACCATGACGAACGCCTGGGGCACTTACGCCCTTGTCGTCGTCCTACAGTCC
TACCCATACTGCCGTGCGCTACCCCTTAGCACCCAACTGATCAGAGGATGTCTGTTAACTCTCGCAGATGCTATCCTAGT
TGGCTGGACATCCAAAAATGCCAATAACGTCGGCGCCAGATCTGTCTCGTCAGCCTTGTACAACGTGCGGTCCGATACTC
CTTGTTCTGTAGATAACAGGTACTAACACTGCTAGATGTCGGTCCAAGTTGGAAACATCGCCGCCTCATACATATACCGA
ACCGACGACGCTCCGCTCTACCACCGCGGCAACGTCGATCTCGTCGCCATCAACATATTGGCCATCGGTGTCTTCATTGT
TACCAAAATGTACTACGTATTCCGCAACAAGCAGCGCGAGAAGCAGTGGAACGCCCTCACAACAGAGGAGCAGGTTGCCT
ACGTCCGAGATACCAAGATCCAGGGGAGTCGTCGCCTGGACTTTCGCTTTTCCCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62