GenePrediction:GLEAN_244 Details

Name: GLEAN_244
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:513459..515628 (+ strand)
Length: 2170
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:513459..513664 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_167:513770..514993 (+ strand)
Length: 1224
Type: CDS
Source: GLEAN
Position: GCSC_167:515076..515628 (+ strand)
Length: 553
>GLEAN_244 class=GenePrediction position=GCSC_167:513459..515628 (+ strand)
ATGAGCCTGGGCTGCTCCTCTTCATCGTCCTTCGCCTCTCCCAAGTCGGGACCGTCCGATCTTTCGCCCAGGGACTTATC
CTGGCTGCAATCAGCTCCGCCCATCTCTCCGCCCATGTCCAGCCATGATCATCCGCCACTGCGACAGTCGTCGGCTGCAT
CCTCCCTTTCGTCTGCCAGCGGCATCGTGCCTGGAGAGCAGAGAAGGTCGGTCGGCTCCGTCGCAGCGGCCGCAACTGCA
ACCACGGCCACGACCACGGCGGCTGCAGCGGCTGCAGCGACAGCGGCAAGCATAGCTTCCATCCCACGAAGCAATCCGGA
TGGTCCTTCTCGGCTCTTCGGCAGCGACAGCGGTGCGCACCACCCGCACCAGCAGCTGCCCTCGCTGAGCAGCCTATTCG
GCCCACCAGAGGCAGTGCAGCCTCTGCATGCGTCCCCACCGGAGCGAGCACAAGCGCCGACAGCGGCGCTGCCTTTCGCA
GCAGCAGGCCCATCACCTCCCCCGCCGTTGTCGCTGGACCGACAGCAACCTTCGCCGTCATCCTACTATTCCAAGCCCCT
CAACCTACAGGCGAAAACATCGAGAGCATCCCCGGTGCTGTCGCAGCAGCCACGATATGTCTATGACTCTGTGAGATCAG
CCGACGACAGAACGTCTTCTTCAGCTTATCAGCAGCATCAGCAGCAGTTGCCGATGCCTCACCAGCAAGATCGGCAGATC
AACGAACGGGAGCCACCAGCACATGCCTCTCTCCAGGTATCGCCCCGAACACAGGACAAGCCAGGTTTGCTCCGACAGCG
AGAGAGCCCACCGCCTTCACAGCCATGGTCTGACTCCCGGCCTGCCTACGTCACCGTGGGCAAGTGGCCGCGGCAAGAGG
AAGGTGGTTCGGCCTACTCCCAAGTTCGCGAGCAACCACAGCCGCAACAGGCTCCTTACCGCCATCATCAACACGAGCAC
CACGGTCAACCACAGCATTACCACCAGCTGCCTCTAGCCGAAAACATCCGATACGCACCATTGTTTCCACCGGGTGACCG
GTCGCCGGCGAGCGAGTACGAGAGAAAGCTGTACCGTAACCAGCCGCCACCAGCGCCTCCACTTCCTCAGCCATCTCCTG
GCAGTCCGTACGGAGGCAGCGCAGGGTCTGATTACCGTGCTCCAATGCGCTCTATCTCCGGGCGATCGTCTTCCGTTTCT
AGGAATGCACCGTCGACTCCAGATGGCGTGTCTGTGAAGGACGGCTTGGGCCCCAAAATCTGGACGGGCACGCATTTTCT
CCCAAGATTTGTGCGGGCTGCAGAGGTGCCTGGCGAAGGCATGTGCTACTTTTACGACGACGGCAGCCACTGCAAGACAG
TGATTGACGGCGAGGCTGTTACCGCCCACTGGGGTGTGACCAAGGCCGGAAAGCCGCGGAAGCGATTGGCCATTGCCTGT
GTGACTTGCCGCGAGAAGAAAATCAAATGCGACCCGGACTATCCTCGATGTGTCCAGTGCGAGAAGCTCGGCCGTGTCTG
CAAGTTCAAGAATGCGTACGTTGTCCAGGGATTTCTTCCCCTACCGGTCTTTGCCAAGTTTTGCCAAGTTTTGCCTGCTA
ACAGATGTTCCGGACAGTCCTCGTGGAGGCAACAACGTTTCGCCGAGCCCATCGAGTGTCGAGCCAGCTGACGGTATGCG
CCGTGCGACTGAGCCGTCTAGAGGGCTTCCTGTCGATTCGCCATGGTCCTTCGGCTACCCTGGCTCTATGGGGTCCCCTA
GAACGACGATGATGCGGCCAGGAAGCTCGGATTCCCGGGATGCAGGCTCTAACAAGCGCATACGGACATCTTTCGACGGC
TATGCATCCGGCAGAACGAGATCGCCTCCCTTGATGGCGCGTCCGCTGCCACACCTCATGTCGTCATCGGCATCTGAGAC
GGCTCTGATGCCTTCGGAAATGGGGCGGGGCGCTGATCTGCTGCCCCCTCTGGCCTGGGGCAGCAGCAGCAGCTCTCAGC
AGCAGCCGCAATTGCATTCGCCACCGGCGCTTTCTCAGCAGCGATACGCACCCTCTTCTCCGCCTCCGGCGGATCTCCCT
CGCATTTTTCTACCACCTCCTCGGTCACACCCCGACCTGCCACGAAAACACAACGACATGTTGATGAGGCCGTGGCAGCA
GGACGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62