GenePrediction:GLEAN_2450 Details

Name: GLEAN_2450
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1181830..1185597 (+ strand)
Length: 3768
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1181830..1184238 (+ strand)
Length: 2409
Type: CDS
Source: GLEAN
Position: GCSC_140:1184575..1185597 (+ strand)
Length: 1023
>GLEAN_2450 class=GenePrediction position=GCSC_140:1181830..1185597 (+ strand)
ATGCAGTTGGCCCGAAGAGCGCCATGGCTATTGTTCAGCGACATCCACTTCAGGCACCTTGACCTTGATCGCATTCAGAA
GACGGCGGACTGGATTACAGCTCTAACACGACAGCGCCGGATCCAACGAGTCGTTATTTGCGGAGACCTTTTGAAGGACC
GCTCTAAGTTATCAACGAACGTGCTGTCGGCTTGCTATCGTTTTCTCAACGAGCTAAGCGAGGCAGGGCCGCATATTCAC
ATCATCCTGGGCAACCATGACCTTGCATACAAAAACGACTACCACACGACTGTCCTGGAAGCTCTGAGAGCAAGCCGGTT
ATCTCCATTCGTTTCCGTTCACAGCGATGTGGCCACAGCCGAATGGGATGACCGTAGGGTGCTACTGCTGCCTTTTCGAG
AAAATCAGAACGACCTGGTCAACGCAGTGGATGCCTTGGATTCCAAAACAGCCCGACAAACGGTCGCATTTGCCCACCTA
GCTATAAACGGCGCCATTACACAGCGCCATGTTGTTGGCGGCACAAATTCGATCACCTACCGAGGCCTCACAGGCCCCGA
CAGATTCGCCTCCCTAGCCCGAACTTTCACTGGCCACTTCCACAGTCACCAGACGATAACTCCGCAGGCTAGGAGAAATT
CTGGTGGACATTGCGACCCATTGCAGGGAAGCATCATCTATCTTGGCTCTCCGTTACAGCTGACTTGGAACGATCTTCAC
GACGAAAAACGAGGCGTTGTTCTGCTAGACCCAGATACACTACAGCATGAGCTCATCGTTTCCCCTTTCGGGGTTGGGTA
CACCACCATAGACTCGGGGATCGTTCTCAGGGGCGAGGCCGACCCCGACGCCATAAAGAGCAAGCACGTAATGCTTACTG
GGGACCTTAGCCGGTATACATATGTCACGGCACGTGACCGACTTCTGGCTGAAGGCGCCAGGAGTGTGCGGAACTGGAAC
CCCCTCGGCCCGGCCCTCCGAGACCAGCCATACGCTCGTGGCGGTTTGGGATCTACCGTTCTAGACAGCGATGTTGTATT
GGAAGAGGCTGCGGCGGCTCCTCGGGCAGAATCTGTTCCCAGTGCACAGACAACTGCTGCTATCCTTGGCGTGGAACTTC
CACCGCCTCCGCCACAACTGGATCTAAGTGCAGAGGCGCGCGAGTATGTGAGCTTGTTGGACCTGGAGAGTCCACTACGC
GAACGACGTGAGGCGCTGATTGATGTTGGCCGTCGGCTTGTCGGTATAACTGGCCAGACCGAGGAAGAGTCAGATGGCGG
GAAGAGCAGCATCTGCTACGAGTCCCTGTTCAAGGCTGAGGTAGTGGAGCCGGACTGGGTCGACAGAGAAACAGGCACCG
ATGCATTGCCACAGCCCAAAGTAGCAGAAACATCTCTGGCTACTCACATCTTCGTGGCCAAACTGCGGTCACTCACGATC
ACCAACTTCTTGGGAATACAAGGCCGACTGCGGCTCGACCTGGGCCGAAACGTGCCCCGTGGTCTGGTCTTCCTCTCGGG
CGAGAACGGCTCAGGTAAGAGCACGATTATCGAGGCGATGACGTGGTGTCAATTCGGACGGTGCATCCGCGGCGGGATGG
CGGCAAACGACGTGGTAAACGACGCAGTCGGTCGAGACTGCAGCGTTGAGCTGGCGTTTGACAATGGCTACACCATTACG
CGGCATCGCAAGAGCCGGACGCATGGCAACAGGGTTCTTGTGTCGCTGCACGGCGTGGTTCAGACGCAGTTCGAGCATGG
CCATTCGCGAGACACCCAGGCGGCCATTGGCGAGTTGTTGGGCATTGACTTCGACACTTATGCCCGGACTGTGGTGCTTG
GCCACGAGAGCACGACTGGATTTCTCAACGCGAGCGGCGCCCAGCGACGAGATCTGATCGAGACCGCGCTGGAACTCTCC
TCGCTGGACCGGTGCAGCGCGGTGTCCCGTGACCTGCTGAAGGACATGGATGCAGATATTGCCGAGGTCCAAGTCAAGCT
GCGCTCGTTGATGCAGACGAAAAAGTATGCTCAAGACCGTCTTCAAGGTTTACAGAAAAAGCAGGAATTTCTGATACAGG
GGCTGGAATCGGCCACCGGAGCAGCAGCAGCAAGCCTCAAAGAGTTAGGGAATCAGAAAGTCGCGGATGAAAAAGACGAT
ACATCCCCAGAGCTGTTGTCTTTGGATTCCGAGTACTACGAGCTTCGAACGCAAATCAGCGCGCTTGATGACCAGATGGC
GACGGTGACACGCAAGGAAAGTGAAGCACTGGCGCAGGTCCGATTGGCCGATGCATATGCCGCATTTCGTAAGAGGAAGG
CGGACTTGCTCAGCCAGCTGCACAACGGTGAGCTGCGACTAGATCGTCTCCAATCTTCGTTCGCCCTGCTGCGCGACCAG
AACACAGAGGTCGGTCCGCCAAGGGATTCTAGTTGGGTAGTCTGCTTTGTTCAGAGATGCAGAGCCGTTCTAGTCCTCAT
ACCGTCTCATTTCAGGCAGAGTGCACACACGCACAAGCTCGTGAGATTTACCAGATGTATGAAAGCTCTCATGGAGCCGT
TTCTTGCTGCTCTGGAAAGCCTGGCTCGCAAACTTGAAAACATTGTATCTGCAACAAGAGCAGAATCCGAAAGGCTTAGT
GCGGGGTATGATGAATTGGTGGCTGATTTTGAGCGAAACATCGAGACCGCTATAAGGAGTAACTCCAAGATACGGGGGCA
AGTAAAAAAAGGAACACTCATGCAGAAAGTTGCCAACGACTTTGGAGTGGAGCAAGAAGATCTTGACAAGGTCGTGCAAG
ATCAAGCCGCGGAGAAGCTAGATCGTGATGCCTTGTGGCGAGAAGTAACAGAGCTGCAACAAAACCGTCAAGAGCTGCAG
CAGCGATACAAGACGTCACGTCTCCAGTACGAAGAGTGGAGTTTAAAGACTACGGCCTACGAACAGGCACGGAAGCTTAT
GAAGGCTAAGCAGCAGGAAGCGGAAATGTATGCGCATCTCGTGGAGACCGAGGAGGGCGAGCTTGTTAGCCTCGGTGTGC
AGCAGGTTAAGATGGGTGTCCAGATGGCGGATCTGGAATCCAACCGTGAACTGCTTGCTTTCTGGGTCTCGACGTTAGCC
AAGAAGACATACCGGACGACGACATCATCCCCAGACAGCAAGGGCAAGGGCAGAAAGGGCGAGAAGGGCAGCACACGCAC
CACATTTCGAGAGTACCTTCTGGACAAGAGCCTGGATGAGCTCAACGGCCTGATGGCCCAAGTGCTGACAGTGCTGTACG
ACGACGCGAACTACGCCAAGGCCACGGCCACAGGTCTTCTGCGCTCGCTGCTTACTGACGGGGACGAGCGTCTTGTGCTG
CTGGACCGGACGCTGCAGGTTGGTGGTGGCAGCTCGGTGGCCGGACTGGCCTATGGCAAGCGCAGCAGTGGCGAGCGCAA
GCGCCTAGACCTGGCCCTCTTCTTCGCGCTCGTGCAGCTCGGCCAGGCTCACAGTCGACACCGGGCGCACTATCTGTTGG
TGGACGAGGTCTTTGACAGCCTTGACACGGCCGGACAGGCCGCCGTGGTGCGGTGGTGCAGCTTGATGGAGGCGCGGGTC
GACCTCGTCCTCATCCTCACCCACAGCCCGTTCCTCGTCCAGGATGGCGATCTGAGTGAGAGTGCTGGAGGCGCTGGCGG
TGCCGTCGCCATGATGACGGCTCGAGGAGGCAGCAGAGGCACTGAGCTGCTGATGAACGGGCGGCAGATCGGACGGGAGA
CTGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62