GenePrediction:GLEAN_2451 Details

Name: GLEAN_2451
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1195610..1198218 (+ strand)
Length: 2609
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1195610..1195624 (+ strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_140:1196078..1196235 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_140:1196308..1196507 (+ strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_140:1197060..1197110 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_140:1197266..1197853 (+ strand)
Length: 588
Type: CDS
Source: GLEAN
Position: GCSC_140:1197920..1198218 (+ strand)
Length: 299
>GLEAN_2451 class=GenePrediction position=GCSC_140:1195610..1198218 (+ strand)
ATGACTGGTCAAACAGTAAGTCATGCTACTGGAATGTTCACGGGTTTAAACCCTTGTTAAGAATAAGGAAGTGAGTCTGA
CGTGGCATCAACAGATCTGGATTACGTTATCAAGGACCTTGCGCCGTAAGTCCCCTCTATTATACTGCATCGTTCCCCAT
CGTCTAATTAGGGCCCCTAGGATGTGGTTTTTCGCCGATGGTGCATGCTACCCCCAGGCGGCCGAGACAAATGGTCAACA
GACAAACGGAAACGGTGCCGATAGCTGTATTATCAGAAAACTAGGGAGCGGGTGCCAGTCTCCAGGAAAGTGGAATGGTG
CTGCTACCCGAGGAACGAGCTTTCCAACATATTGGACAGTGTCCAGCTGCGGAGACTCCACGAAACGAGTCTGCTATGAT
ATATATTTCCGACATGTAAGCAGCGTTCAAAATCTGACAGGCAGTGCCTCTTTCTGACGATACAATAGGACTCCGGCCAC
GAGTCCGACTGGGAATGGGCCTGTGTTGTGCTGCAGAAAGGCTCAGACAACCTCTGGTACCGACGGGGCATCTTCATGGA
GCAAGACAACAAAGGCGGCAATGGCACTCCGTACTACTCTTGGGGATCGTTGGAGACTTTCGACGGGTCAGTATTACGAC
TTTCCTCTTTTCTCTCATCCATACATGCAGCGCAGCATAGTAACTTGTCGCTTCACAGATCCGATCCCAAAAATACTGGC
AGCAGAAATGGCAATCACGCCATGATCTACAGTGCCAAGTTTCATCACACCATGTTTCCTCACCAGTACAAGTGCTTGGG
TAAGAACAATTGTGCAACCGATGTCCAGCAGATGTTCCGCAACAACGACTTTGTCTGGGCTGCAGCCGACAATCTCGTCC
CGGGTAGCCGTATTCCTAGTAAGTTGCTCTTCTTAGAAGCTGTTCGGTTCCATAACTGACTAGGCTCTCAGGTAATTGGG
TTTGGGGTCAGGCGTCGTCGAATCCGTTGCATTTGCAAGATAGCGTGTGCAGTTTTACTCTGGATAAGGGCCCCAGCTAT
AGCAACCCGCCCGGTTGTTAGACAAGACAGATTTGAGATGTGAATGGGTGGGGTGGAGAGGTCCCTCAATATTGTACTCT
GCTAGCCTGTCTGCATCGTCTGTAATTGCTTGACCTTGCAGCAATCGTACACCGACAAGGTTTTCTACAGGACGCGTAGA
TAAGATAGCTTCAATGCCAGCAGCAGACAATTGGCCCATCGAGAGAACTGAGACCACCACAAAATAGACAAACTATACTT
TAGATCAACCAGTTGGCTTTTGCATGTCGCAAGAAAGACTTTGTCTAGAAACTGGCCAAAGTTGTCGCGGTCTACGATAC
GTTGTTGTTGTCTATTGCCTTAATGGCTGCATAGCGTAATTATTGGCCGGCGCTACTCCGTACTTTTGCAAATGATTGTC
ATGCGCTCAGCCTCGCCTCGGCCCCACGATGTAACTGGACCCAACCGGACCTCGGCAGAGTGTAAGTACGACGTATACGT
ATGCATGCCGATCTTTTTAAACTTCGTGCTCTCCTCCCCGCATTTTCAATGTTACCCTCATTCTTGGAGATCGCCATTGT
ATCCGCAATTTAACCTCACCCTTCAACCATGGCGACCACATTACAGCAGCAGATAGCCGTTGTGCCTACCAACGAGCCAG
ACCGCTTCGTTACGGTGTCCAATCCTGGGCGGATGGGCAACTCGAGGGACATTGCATATGGCGGATGTGTTGTTGGGGCC
GCCATTCGTGCCGCCTGTGAGACCGTCGACCCCAAGTACCGCTTGTACTCGGCCCTGGGCCACTACATCGGACCCGCGTC
TACCAAGGCCAAGCTGCTCTGTTCCGTGCGCCGCATCCGTGACTCACGCACATTTTCAACGCGGCAGGTGGAAGTTAGCC
AGAAGGAAGAGAAGGAGAATGCGCCTGTACGACCATGCGTGATCGTTCTCATTGATTTCCAGGTGCAGGAGAAGAGCCTG
GTCCTGCCCGAGTACTCGGCACAGCCAGAGCGGACCTACTCGAAGCACGAGCATTGCCCGAACATCACCGACACATCGGA
CCGGCTCGTGCGCGAGCGCGTTGTCTCTAAGCCCGTGGTCGAGATATTCAACATCAGCTTCAGCCTGCAGCACCGCTTCT
TCGAATCGCTTGACTGCCCCGAAGGTGTCGCTGGCAACAACCTCTACGGCTTGGCCAAGAAGCGCGCACGCACGCCGCAG
GACGGTCTGTCGCTGCCGGAAAAGACCTCGGCTGGCTGGTTTCGTAGCCGGCACCCGCTGGAAACATGAGCTGACCACTA
CGCCGGGCTGGGTTTTGTGCTGGACGGCGCGCTGTCCTTCCTGCCGCTGGCGCACAGCGGCCTCTTTCTGGACGATGCTG
GGGCTTGCTCGAGTCTGGACTTTGCGCTGCGCTGCTTCGGGACAGACGTCGACCTGAGCAGCTGGCACTTACGGGAGTTA
AAGACGGTTACCGGACAGAATGGGCGGACTTACTCGGAGGCGCGATTGTGGGATGAGAACGGCCGGTTGGTAGCCAACAT
GACGCAGCAGTCGATCCTGCGACCTCTGCGGCCCTCGCCATCTCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62