GenePrediction:GLEAN_2452 Details

Name: GLEAN_2452
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1207350..1207926 (+ strand)
Length: 577
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1207350..1207661 (+ strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_140:1207906..1207926 (+ strand)
Length: 21
>GLEAN_2452 class=GenePrediction position=GCSC_140:1207350..1207926 (+ strand)
ATGACTCGGAGGGATAACCTCGAAAGGCATGTTTCAAAACTGCATGCAGACGACTTGTGGGTTGCTGCTGCAAGCGGTAA
TGAGGCTGCTATGAGCATGCATCTCGATGTAGGAGCGGACATCGAATCAAAAGATTCCAACGGTCGAACCTTGCTATCAT
TAGCGGCTATGAAAGGTCGCAGGTCCGTGGTAACACTACTGATTAAAGCGGGTGCAAACATTGAGTCACAAGACAACGAA
GGCTGGACACCTTTGTCGCTGGCCGTCGCGAACGGCCATGAGGCCGTCACTGAGCTTCTACTCAACCTGAAAGTCAGTGT
GAAGTGGACGGATAACCAGGGCTTGACACTCCTGAATCATGCGGTTGAAAATGGACATGAGACAGTCGTCAAGCTATTAC
TCGAAAAGGGACTCACTGGTTATTTTCACGGCGCCAGGGACGAAGCTGCGCTTCACTCCGCCTGTGTCAACGGAAAGGAG
ACCATTTGCAGATTCCTACTCGAGGCGCGTAGAAATCCTTATACTTCCGTTAACCTGACAAATCGTCTTTGCACAGCTTT
GGAACATGGACCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62