GenePrediction:GLEAN_2453 Details

Name: GLEAN_2453
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1211289..1213115 (+ strand)
Length: 1827
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1211289..1211799 (+ strand)
Length: 511
Type: CDS
Source: GLEAN
Position: GCSC_140:1211869..1213115 (+ strand)
Length: 1247
>GLEAN_2453 class=GenePrediction position=GCSC_140:1211289..1213115 (+ strand)
ATGGCCGACACAGCCGACAAGGCCACTATGGCCGGCAAGAGAGGTCATGCTCACGATGAGAACCCGGTCAAGTCGACGAC
GCTGCCGCCGATGGACGAGAAGGACGCCCTGGCCGCTGCTGCAGCTGGTGGCTGGGAGGTCGACGCGTTCATCGAGGAGA
TGGAGCGCGAGCTCGAGGCTGCCGGCGGGCTGGACACGGGATACTTGCAAATCCAGTTTAGCGACCCACGCTACTTTACC
TGGGTCATTGTTGCCTTTGCCTCCATGGGCGGCCTGTTGTCGGGTCTGGACCAGTCGCTCATCTCAGGCGCCAATCTCAG
TTTGCCAAAGGCTCTGCACCTCGACACCCACCAGAACAGCTTGGTCAACTCGGGCATGCCGCTGGGAGCTGTTGGCGGTG
CCCTGATGCTGTCACCGTGCAACGAGTACCTCGGTCGCCGCTGGTCCATCATCATCTCCTGCATCCTGTACACCATCGGA
GCAGGCCTGGAAGCCGGCTCCATCAACTATGGTAGGTCCTCTTTTTTTTCGTGCGGGGCTGGTTTTAGTCACGTGCCTCG
CTAACTTGAACTCTCCACAGGCATGATTGTTGCTGGTCGTGTCATCCTCGGTCTCGGTGTCGGCCTTGAGGGCGGCACCG
TTCCTGTTTACGTGGCCGAAACGGTCGAGCGCCGTGTACGCGGTAACCTCGTGTCACTCTATCAGTTCAACATTGCTCTC
GGCGAGGTGCTCGGCTACGCCATCGCGGCCATATTCCTTCATGTGCGCGGCAACTGGCGCTACATCCTCGGCTCGTCTGT
CGTCTTCTCCATCATCATGTTCATCGGCATGCTCTTCCTGCCAGAATCCCCGCGCTACCTCATGCACAAAGGCCGCGTAT
TGGATGCCTACAAGGTGTGGAAGCGCATCCGCGGCATCGCCACGCCCGAAGCCCGCGAGGAGTTTTTCGTCATGAAGGTC
TCGGTCCTGCACGAGGCCCAGGTCGTGGCCGAGAGCGCGGTGAACAAGAACATGCCGTGGCTCGACTTCTTCACCGTCCC
ACGTTGCCGCCGTGCGCTCATCTACGCAAACATCATGATCCTCCTCGGTCAGATGACCGGTGTCAACGCCATCATGTACT
ACATGTCCGTGCTGATGAGCCAGATCGGCTTCAACGATGAGAAGTCAACATACATGTCGCTCGTCGGTGGCGGCTCCCTC
CTCATCGGTACTCTCCCTGCCATCTTCTACATGGAGCGCTTCGGCCGCCGCTTCTGGGCCAACGCCATGCTGCCCATCTT
CTTCCTTGGCCTCGTCCTCATCGGCATCAGCTACCAGATGTCCCTAACCACCAACCTGCCCGCCGCTGAGGGCCTCTATC
TGACCGGCCTCATCATCTACATGCTCGGATTCGGCTGCTATTCGTGCCTGACCTGGGTTGTGCCCTCCGAGGTCTACCCG
ACCTACCTGCGCTCGTATGGGATGACCACGTCTGATGGCCTGATGTTCCTCTTCTCCTTTATCGTCACCTACAACTTCTC
CGCCATGCAGACCGCTATGACCCGCACCGGCCTCACCCTGGGCTTCTACGGCGGCATCGCCGTTCTCGGCTGGTTCTACC
AGCTGCTCTTCATGCCCGAGACCAAGGACAAGACCCTCGAGGAGATCGATGTGCTCTTTCAGCAGCCCACTGGCGAGCTG
GTCGCTGAGAACATTCAGAACATCAGCCGTTCGTTGGCTAACTTCTTTGGCGGCCGCTGGGGGAAGAAAGCCTCCTCTCC
GGTGCCGCCTGTCTCGGCCCATAAGAAGGAGGAGATGGAAGACGAGCCAGAGCCGGAAATTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62